Description :
From Genome Similarity Track
Location :
Scaffold_25:113407- 117431
Transcript NameFunction/comments
Albla_Nc14029070transposon protein putative
Albla_Nc14029080

Sequence
4024 bases(100 bases per row)
CAACGGCACACATTACTCGATGGGCTACTATCTGGCGGACAGAATCTAACCGCCATGGGCAACACTGGTCCAGACAATCTCCAATCCATAACCTAAGAAG
AAAAAGTTATGGAAAATGCTGGTCTATTTCATATTGATACTCACTTGTGTGCCACTAGTTTTTTGCTGAAGCACAGGAATCGGCGAGAAGAGATGTCGAG
CGAGCGTTCGGAATGCTGCAATCCCAGTACGCGATACTGACAAGACTGTGCCGTCTTTGGAGTCAAGAAGACATGGCGTACATTGTGAAAGCATGCGTCA
TCCTGCACCACATGGCGATCGAGGACGAAAGGGATCCCGATGGAATCATTTTTGAGAGGAGTGTGCAGGACAGCATCACGTCCTCCGGCACTGTCGTCAC
CGCTCCTAATCAAAGCACAGATAGATCATTTACGAGCTTCATTGGTCGGTACAAAGCTATTCGAAGCAGTGAGCTGCACTATTAATTGTGCAATAATCTA
ATCGAACATCTCTGGGCTAGAAGTGGTAATCAGAATGCGCAGTAAAGTAATGACGCGGCTCATAAGAACTCATTTGTAAAGAATATCAAAGTACCTATGC
AGCATAATACACTCCTTCTAACTCTTCTTCCAATGCAACACTTGGTGCGTCGGCATCTTCGTCAGCAAGCGAGATGAGCTCAGGATCCATTGCCATGGTG
ACAGCGTGCGCCAACTCAATCTCTTGTTCTTGTTGACGTAGATCTCGAAGAATACGACGCTTTTGTAGCATGAAGTATTCACGGGCAACTTCGTCCAGGA
CTTCCACGTTCGTGCACATGATCTGGTTGTTCGCATACAGTCGCTGAGATTCAGCAAGCTTCTCGAGAGCGACAATCTTCTTCTCTGCTATCACTGCCAA
TTTGGCGCTGCTCTTGGCAGCACTCGAAAGACTTTTGGCGATCGACGTGTCAATTTCAGCTTGACGTGCCTGATACTTTGATCCACGACGACCAATTGGG
CGGCTGGAATTGTTCTCGCTGAGCTCTGCATTGCTTGAAACGCTAGACTGGGGCGAGCTTGCTCGTTGCGACTCACTCTCATTAGGTTGGCTGCGTTTGA
GGCTCTCCTGCAAACATCAGCAAAAGTTAGTGATACAATACAGCGACGCATGTTGCCAGAATAACAGACTCACTTTGCTAGGATCGATAAATCTCTCCAC
TTCTGGCAGTTCTTTAGCAGCTCCCAACATGTCACGTGATTAAATGGTTTGCCACGATCTTGTAAATAGAGCGTATGCGCGTCAGCCAACTTCTGTGTGA
TGGTTGCGCCACTGTCGTTACGCCTCTGAATAGCTGCCCAGCAGCCTGAGAAACTTGCATACTGCTTTTTGAAGAATATGCCAGCGATTCTTGCAGGCTT
CGTTTTTCCGAACGTCGTCAAACGACCTTGGAAGATGCGCCGAGAACTCTGCATGCACACGATCCCAAAAATGTTCGGCGCGCTGCTCGTTGCCCGTGAC
GGGGTCCTGCGCGATTGCCATCCATGCTCACACAAGCGTGGTGTCCTCAGCCTCCTTCCAGTTCTTCCCCTTGATTACCATTTTCAAACTACGGTGTTGG
CAAGGAGACACAGATGAAGTACAGTAGTGGTACAGGAGTGGTACACGTTAGCGAAAATGGTGTGAAAGCTTGGGCCTAATTGGCAAACTGTGTTTACCCT
AACCATTATTTTAGCCCAAGTACCAAGTACGCCTACAAACCGAAAACGTTAACTTAAATCCTTCTAACGAATAGAAATGAAAAACTCATCGGGTGGAGCT
TTCGGCTTTCTGGCTAAAGTTAAACTTGATTTTGCTACTTTTCTGTACTTTTTATAAATGATTTCAACTATAGCATTTGGCCATGATTGGAGATGACCTT
ATCTTGTAAGGCGTGGCATGGTATTAAGTCCCCTTACATTAAATGGAGTGCTCGGCTGTGAAGTAGGTTTTGCGGCACTCAGCTGTATCCAGTTTTGAAT
TACTAGAGCTTGATGGGAAAAATACGTTCCAGAAATCTCAGAATTTGACGAGCGAGCCAGATCGACGCTCCATCAAACGCATCTTGCAGAATTATATTGT
TTGACTCGGTCATAGCGATAGTGAATTTTGCAAAATGTGAAGCATGCGATGGTTTATGTCGCGCACCGTATAAATAAGGAGTCCGAGTGGCATGGATAAG
AGTGTACCCCTGGGGACGTTACAAAGGGTAGTCAATGCACACATATATGCTGCTATGGCTCGGGGGCATTTATTTCCAACATTATATCCCCTCTCTGTGT
TATTACTCTTCTTATCCAAAGAAGTTATGATAGATGGTCATCTCGAAGACGCGCTCTATAATTCACCCTTTGATGTACAGATAATCGACGTGTCAATCCT
ATTATAGATTCCACCTAGATTCGCAGAATAGCTGCACAGGGTAGAAAATCGTAGTAGTCTTAGGCAAGGTGGCTATCATAGCTTTGTACCTTTTGACAAA
TTCGTAGCGTCGAACATTACAAAAGTGTAGTGATCGGGATATTATCATTTGCTACAGAAATACAGTGCAGAAAACATCAATTCTTTAGCCGTTAGGGCTT
TAATGTGTATCCGCTATTCGACGGTATGCAATCGTAAGAATTTCATCATGTTGTGGATGACGATTGAACGAGCAGCATGCTGTAGTGCAAATTGAGAAGA
AAACTAGCGTGTACATTCCCCAGTAAAATATTACACAACGCATCAGCATTGTTCTAAAGTAGCTGTCGGAATGAAAGCGATTTTGTTCTGTTGCATGCTC
GTTGGCCATTGGTGCTTTCAATGTTGCGCCGACAACTTAGATTCATTTACCATTTCCGCGAGTACAGCACAATATGGAGTTTGTCAGCACTGCTTATTGG
TACAAGCAGGGGCCATTCACGTGGAAGAGATGGAAGTAATCTCACATAGACGAACTTTGACCTACTGGGTCGTGGGGTCACCAAACTTCCTTGCTGCTAA
TCTGATCAGATGCAATACTCCCTTCGCATGTCATAATGTGGTGGTCAGAAAGTCTTACGCACATATTGCTATTCAATGCATCGGTGGGATATTTTCATCA
CTTACATCTATGAACAAGCCAATCGGAAAATCTATCAGCACTCAGCAGACACTTTCGGAGATGCCAGTCGGCATGCCAGAGAACATCGAGCTGATCTCCC
GCTTGAAACTAAGCACATGAAACAGTCAAACTCGGCTCGGAATCGACAAGAACCCGAGCTATTGTGCCTTCTTAGACACGATATATCACCTTCCATTTCG
TGTGAGACATGTTTGCAAACAAAAAGCTGATCTGGCAAGTTGGAGAAGTGTTTCGTGAAATATGAGTCACACTTCGATGTTTTCTATGTGATTAGAACAT
CGGATTTTAAGTCGTTGATGAATTTGTGTTACAATTGGAAGTTCTGCAAAGGAGCTACTGCTATACTTTCAACTAATCTTTGCAAGCTGTTCAAATATAT
AGTTACGTCGATTAGGGATCGGTCCGACAACATGCCGAAAATAAATGGAGCAATCTTGCAGAATTTCAAGATGTTCCCTGCGCAGTATTCAGGGAAGCGA
TATGAAAATTTGCTCGAGTAAAAAGTTCGAAACATTAACGTGACAACGCACTGTCTGACAACAGATCGTGCATACAACAATAAGAACGGCCTTTGCTGGG
GGTGCTTGGCCACCAAGCAGAAGGGAATGGTAATTTTGGATAGATTCGAAGCGATCCACCAAAAAGGTCAAAAATTTATCCCCTTACTATTCAAGAACAG
CACGATCAAGCTTGATTTGGAATTCTGCCATGGACCTGTGGAGCAATTGTTGATAGGACCGATTGCATGGAAGACCCCATTCATGTGACCAAGTTAAGTT
CGACCAATAACATTGTAAGATGGATGGGGCGAACAGGGAATGCACTACTGGGCAATCACGTGTCAGACTTCACGTCTATTTGTTTCCTGGTATGATACTT
GCCCGAGGAAGCGTCGAAATGTCA