Description :
From Genome Similarity Track
Location :
Scaffold_626:11339- 12342
Transcript NameFunction/comments
g16461.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
AAAGACGATAGCGCCGACGCGCTTCAGAGCTAAAAGGGCACAAAATGCGCCCTTGTAGGGCCCTCTTGCCCACCGTGTTTTGCAAATGTGCTGAAAAATG
TACCCTTCTACCGCGAAAGGGTTAATAATACACACCCTTCACTGTACATATGTTCCCGACAAAAAAAGGTCGGATCAATAAAACTGCGAGGCTGCACGAT
TCACTCAGGTGTCATACAGATACTATTCCGTTCCATTACAAGAGCACGAAGCTTGAAATATGATGCGTTTAAATTTTGTAACAAAAGGTGTTATAGCCTG
TATCAAAACACGCGACTCGCTGCTGCCAGTAGTCTGGTATACTCAGTTGTCTATAGAGCTCAGTATTGGTGACGCAATGGTTGGTTGAGTGGCGCTAGCA
TGCCATCGCTGGCTGGAACGTAGATTCTCAAACGTAATTTCGCCCATCCTCGCCCAAAGACCACCAATTACCATGGAAAAGTCAGCCCCGCTAGCAAGAC
CAACCTAACTGGGCTTAGCGTCTGCAATTTTCACTATCGCACATACAGCGAGACACGATGTTGTACGACAAGATGTTCGACACCGTGCACGTAAACAAAA
AACTTTTTTACATCACTCAGGCTTCCTGCTCCTGCCTGACGAAGAGGCACCTGTTCGACTACTTCGCAGCAAGCGCTACATCACTGAGGTGATGTTCTTG
GCTGCGGTTGGCCGTCCGCGCTTCGACCCCGTAACACACCAGGTCTTCGACGGAAAGCTGGGCACCTGGCCCTTCGCTGAGCGCGCGCCAGCCCAGCGAT
CCTTAGCGCCACATGAAGAAGGCGAAGCTAGAGCGGGAGGGACGACCCCCCTTATCAATCCGCTGTTGCTTCCGTGCCGAGGAGATACTAACGGAATCAG
CTGCTTTGTAGTCAGCAGTCCGATTGTTTAATCTAGTTTAATTTTCGTGCTCTTTTAATGAAACAACGATCAAGTTGGCTTCGTGCTCTTGTAATGGAAC
GGA