Description :
From Genome Similarity Track
Location :
contig_11:11336- 13538
Transcript NameFunction/comments
g2535.t1hypothetical protein

Sequence
2202 bases(100 bases per row)
TCACGTTCATCGACGACAAGTCGCACTTCTGCGTCGTGTACTTGCTGAGGAACAAGTCCGAGGTGGCTGCCAAGTTCGCGGAGTTTGTGGCGTTTGCTGA
AACTCAGACCGGCAAGCGCGTGAGACACTCCGGAGCGACAACGGTGGCGAGTACACTTCCGGGCGATGGCCAAGTTCTGTGCGGACCGCGGTATCGTGCA
GAAGTTCACTCCGCCGTACACGCCTCAGCTGAACGGAGTGGCCGAGCGGATGAACCGGACGTTGGTGGAGTGTGCGCGCTGCATGCTGGAACATGCCGGC
TTGCCCAAGACGTATTGGGGTGAAGCGGTGATGACGGCTACGTTCCTCCGTAATCGGTGTCCGACACGCGCCGTCAGCCACGACAAGTCTCCGCACCAAG
TTTGGACGGGCAAGAAGCCGCTGCTGGCGAACCTGAAAGTGTTCGGTTGCCACGCGTATGTGCACGTGCCGAAGGCGAAGCGCACCAAGTTCGACGCTCG
GTCGGTGCGCTGTCGGTTCCTGGGGTACTCGGAGCACGAGAAAGCGTATCGATTCGAAGAACTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGACGCGCAG
TTCATGGAAGACGTCTTCGACAGTGGGAGACGCGACTACCATCAGAGGGAGGTGGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTCGTCGCAGT
CGGATGAAGACGACAACGAAGAAGAGGAAGGGAAGCTGCGCGGGACGAAGACTTCGGGCCCGGCAACAAGCGACACCCGCGGACGCAGTCGCTGGAGGAA
GTCACGGAGGTTCCAAGTGCCAAGCGGTATGCGTCGCAGAGTCGACACCAGACTCTGGACGAGATGTCTGCTGCGGCTCAAGAAAGTCAAGACTTCGAAG
CTGCGTACGTCGTGGATTCAGTGGGAGAAATGCCGACCACGTTCAAGTCGGCGATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGGCGTGCGACTCGGA
GTGTGACTCGCTGCTCAAGAACGACACGTGGGATGTCGTACCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGGAGAAC
CAAGCTGGAGAGATTGAGCGGTTCAAGGCGCGACTGGTGGCCAAGGGGTTTTCGCAGAAGTACGGCATCGACTACGACGAGACCTTCGCACCAGTGGCCA
AGTTCACGTCCATCCGGATCGTACTGAGTCTGGCTGCCAAGTATGGTCTCAAGCTGCACCAGATGGATGTCAAGACTGCGTTCCTCAACGGTGTGCTGGA
CGAAGACATCTACATGGCACAGCCGGATGGCTATGTGGACGAAGACCACCCGGACCACGTATGCAAGCTCAAGCGGTCGCTGTACGGACTGAAGCAGTCG
CCGCGCATGTGGAACCAGACCATCGACGACTTCATGCTCAAGCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCGTCTACCTGAAGCGTGACGGCCAAG
ACATGATCTTCGTGGCGCTCTACGTTGACGACTTGGTCCTCGCTAGCAGCAACGACGAGCTGTTGGAATCGACCAAGCACGCGTTGAGCAAGCGGTTTGA
GATGACGGACCTCGGCGAGCTGGAGTACTTCCTCGGGATGGAGATCAAGAACGACCGCGACTCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTCAAG
TCCATCCTGACCAAGTTCGGCATGCAAGACAGCAAGCCTGTGAAGACGCCGCAAGACCCCGGACTCAAGCTGACCAAGAACATGTGTGAGGGTGGCTGCC
AGCATGAAGACACGATGAAGAACGTGCCGTATCGGAGTGCCGTCGGTGCTCTCATGTACTTGATGGTGGCAACGCGTCCGGACCTGGCTGCTGCAGTGGG
GAGTGCTGAGCCAGTTCTCTGCCGACCCGTGTCCGACGCATTGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACGCATGGACTCGA
GTTCTCACGGGAAGACAGCCTTGGTATGTGCGGCTATTCGGATGCGGACTGGGCCGGCGACATCGAGTCAAGACGGAGCACAAGCGGCTACGCGTTCATG
ATGAACGGGATGCATCAGCTGGAGGAGCAAGAAGCAGCGGACGGTGGCGCTGTCTTCAACGGAGGCAGAGTACATGGCGCTATCGGAGGCGACACAAGAG
GC