Description :
From Genome Similarity Track
Location :
Scaffold_299:11336- 21400
Transcript NameFunction/comments
Phyag_g4445hypothetical protein
Phyag_g4446hypothetical protein PHYSODRAFT_496973
Phyag_g4447hypothetical protein PHYSODRAFT_348671

Sequence
10064 bases(100 bases per row)
CttcgtgtcgtcgtccgcagCGGCGTCGGGCAGCGGCGGTCCCACGTCCTTTAAAGACGCGGCCACAGGAGGAGGCAGTGACGACCACCGAGGGGATCGG
CGCAAGAACAAAGTTCTACGGTAcagcaaggaggagctgctggcgctgcattTCACAACGTCCGAGGCACCCAAGTTCCCTCCGGACACGACGGTGGTTT
CGGAGCACAGTCTGCCGCCGGTCAGCACGCTGCCATTTGACTACGAGGAGATCTACAAACAATGGTCGCTCAACCGCAATCGCGGACGTGGACGCGGCCG
TGGCAATACGACCTCGGGAGGGCAGCAAAACACGCGTGGGCATCAGGAACGAGGATCTCGTGGGGACGAGACGGAGGGGGgagccaagcagcagagagaC
GAACATCATCGACACAACGAGAGAGACTCGACGTGGGAGCGCGGCGCCAAGATCACGGAAGGAGAGCACGGAGACGACGTGTGGGACGATGTACTGGAGC
CAGGAGCCGACAGCAATGAAATGGTGCGACTATTCGAGCGAGATGTTGGTGTTTGGATTTATTCGACGACTAATAGAgttggctgctgttgtttACGCGA
TTTCAGGACCTGTCGAGTATGGCGGAGGCAGCGGAGAAATTCCGACGAGAGATGGATGCGATGCGAGAGGAGCTCGAGGGACCGAAGATCGACCCGGTAA
GGCTAAAGTCATATCGGGAACAAATATGTACGAAACCTGATCGTGAAATACTTTGATAGGACGAGATTAAGGACGACTTGGACGCGTTCGACAAGAAACT
GGAGGAtgcggcagcagctggaCAATTTGATGACAGTGACAATGAAGAGGTGCAATGGGATGACCCCGCCCCCGAGGAACTACACAGTGCCAGCAATGCT
AACGGTCCGCTGGAAGACAACGCAACGAATTTGTTGGGCCGTCAGTCAAGTGGCAGTCGCTTATTTGATGCGCTGGAACCGGCTGGCGAACAACTCGTGC
TTGAAGAGAAGAGTAGTTTCTCGTTGCCTCAAATGCCAGCTGACGAAGGTTTTGCGGGGCTATCGTCACTGCGCCTTGAAGTGGAGGACGAATGGTTTTA
CTTGGACCCGCAAGGATTGCAGCAGGGCCCGTTTAAAACGGCGGAAATGCGGGAATGGTTTGAGGCAGGCTACTTTAAGCCGCACCTCCCGATTCGCTTC
GGTCGTGAGGGCGTTTTCGCGCCCTTAGCGAATCAGTTCGTCCACGGTGAAATGCCTTTCGCGGCCCCGCCAACACGTATGAGCGGTATGGGAGGAATGC
ACGCTGACCCTCACCAaagtgagcagcagcgtttAATGGaaatgcagcaggagcagcagcgtcagcagcaaatgatacatcttcaacagcaacaacagca
gcagcgaatgcTTCAGCTGAATCAAGAAGAGAAGATTCGCATGGAGATGCAACGTCTTGAACTCGCCcgtcaacaacagcagacgcagttgtatcagcag
catcagatgctgcaacatcaagagcagcagcggcaacaacaacagcagcagcaacagcagcagcaacaaatgctcctgcagcaacaaagtTCGTGGCAAC
GTAGCCAGCGTGAGGGTATTATGACCGCGCTGGGCATGTTTGGGGGGAGCCAAGAGAGCAATATCGGAGCAAATGACCAGTTCAGATCGGACGGCATGCA
GATTCAATTCCAGTCAGACTACCgcgcgcagcaccaactgAACCTGCATAACCCTCAGCCTCTCGGCCAAGACTCGATGTTCCTAAACGATGAAGTCCAA
AGACGCGACCAGGCGTTTTGGCCTAATGCAGCCCCTGAAATGTCCGGATTGGAGAGCGCCACGAGTACTCTAGGTGACTTGCAATCGGCACGGCCAACAA
GCCCAATCGCACCGGAACCAACCCAGCCTCTTGCACCAGAAAGTCCGCCTGCTGCCCATGTGGGAGATGCTTGGGGAACTAGACCAAAATCCCCCGAGCG
TCCGTCACCAACACTTCAGGATATCCAGAACGAGGAGAGGCGCCGTGCTGTCGATGATGCTCGCAAAAACGACGACGATCATATTGCcgtgcagcaagag
cagaCCAAGGAGGCATCGCCTAGCAAAGTTACCAAGAGAGATAACATTGTTAGCGAAGGCGATGAGAAGAAGTCGAGTCCAGCTAAAAAGAACGGGAAGA
AAGAGGAAATGAACGCGTGGGGTACCAGAGCGGCACCTGCTGTTGCGTCTAATAActccaagtcgctgaaggaCATTCAACAGGAAGAACAGCGCGAAAT
GCTTAGCAAGATGAGTGGGGACAAGGCCGACTCTGCGAATCTCGCGCAAATGGGGGCACAATTAAAGATGATGCTGGGCGTGGACTCGGCGGCTGTAGTA
CCAAgtgctccttcaccttctgtACCACCGGTCCCAGCAACCAAGGCAAAGTCAGCACCGACCGTGGCCTCAACTCCTGCCGCTCCCGTAGCAAGCCCGT
GGGGCACACCGGCCGCCGTGACGAAGAACAGCTCTTCAAAATCCATGCGTGATATTTtggcagaagaagaacacctGGCGCAGGAACGAGCTAAAGCCAA
CGAGAATGCGCCGACGAGTTCGCACTGGATGAACATTGTGGCCGGCAACAagatcgctgcagcagcaatcccGAAACCATCACGGTCAGTATTGGGCCCT
GTTCCCGCTTCCGTGCTGAAGAGCCGACAGCAGATCCGTGCTGCCAATGGCGCACCGAAACCATCCCCGCCGAAGGCGGAGAGCGATGCGTCGTTCTGGA
ACTTTGGAGCAGCACAGTCTGCTGCGCCCAGCAGTGCTCAGGCAGGCAGCTCGAATGCGTTTGGCACCAACAACGTCTCGTCGGAGTTTATGACGTGGGC
tgtgaagcagctggagacgattgacagcagcgccaacgtgacgttgctggagtACTGTGCGTCGGTGGAGGATCCCGGTGAGATTCGTGAGTACCTGGCG
GCGTATCTGGGCTCGACGCCCCGTGTTTCTGCTTTTGCCACGGAGTTTATTCAGCGGAAAAAGACCCAGCAGAGTGGCAAGAAGTCACCAGGACACCAGG
acgcccagcagcgtgcATCTGAAACAGGATCATCGAACAAGCGAGGCAAGCGCCGCTCCAAGGGCCAAAAGATTGATCCGTCGCTACTGAACTACTCCGT
GGGTAATTAAGGAGCCTGCGGTGCAAGCAGTAAGCAGCGACGAGCTAGTGCGTTAGTTGCGTGGTAGGAACAGGTTGGTCAGGAACCGCAGAGAAGAAAT
GGTTTCCATGCCCATGTTGAAGTCATGTTGAAGGTTCTAGGTAGAAATGGGTACATACATATCCGACGTGTGGTACAGTGTTCCGTACCCGCTTACGTAC
GAAATCTGGTAGTAGGGAGCTCTTTGGCCACTTCGGTTTTCTGCTATAGCTAGCTAGCAAGCGCAGTCGCgatggacgaggagacgaagaTGGAAGCGGC
GTCGGCAGTGGCCACCAGCGGTGAGGAGAAGCGCTTCGAGATCAAGAAGTGGAACGCTGTGGCTCTCTGGTCCTGGGGTGCGTTCGTCGCGATAGCATGA
ACTGGGTAAAAAGTCAGGATCTTTCAGCAATGGCTAATAACTCTTTTTTATTTTATTGCGCAGACATCGTGGTGGACAACTGCGCCATCTGTCGCAACCA
CATCATGGACCTGTGCATCGAGTGCCAGGCCAACCAGGCGTCGGCCACCAGCGAGGAGTGCACAGTGGCCTGGGGCGTCTGCAGTACGTCATCTCGAGCG
TGTCTGGGTTGAAACGTGTTCCTTATTATTATTTTTATTATTCTTTTttgtttgctgctttgtGCAGACCACGCCTTCCACTTCCATTGCATCTCACGAT
GGCTCAAGACCCGCCAGGTGTGTCCGCTGGACAACCGCGAGTGGGAGTTCCAGAAGTACGGCAGATAAaaagaagacggcggagTGAACTCGAAGGATAC
AGGACGGCTGTGTGTGTCTGTCGACTGCAGAAGCAAATGGAGGTGTGAAGTACTTTTATGCCCACTCGCACACCAAGTTTGAGAGGAAAGAGAAATGCTC
GCGCAAGAGTTTAGCTGCTGAGGCAGTAAGTTCGTTCATCTCATTTAACTTCTTTTTACTAACGTTCGGTATCAGTAGATTTTGAATTGACGGTGAATCG
GTTTACGGACTATTGAATGCCCGACGATGGTCGAAGCTTCTTGTCTTCGAGAATACATAAGTTCACAAGTTGTTTTACGTCCACAGCGAGAGCACGCCCA
TGGAGCCGTACCCAGCAAGCAGAGCTGAGCACTTCTCGAACTGATACCGCGGatcttgcagctcctgcggGATAATCTCCATAATGGCGACGAACAGGAA
AGTGCCGCCGGCGAACGCCGCACAAACTCCACCCGCAGGCGTCGCGTGGTTGGCATCTACTAGCAGCCGACCGAACAGGATGCCCGCAGGTGTCATCAGC
GAGAAGACCGCAATGGACATGAGCAGCTGCTTTCGGGAGACGTTGTGgtgcaggaactcgagcGCCAGCGCGAACGCAGCCAGCGATTTGTGAGCCAAAA
TGGCAATGAGGATATCCCACGCGGGCGTGCTGGAGGCTCCCATGCCCATGCCTTCCATCACCGAGTGGAACGACAGTGCGATGAATACCACAAGGGCCAG
AATTGGGTTGCCCTTCACGATACCGTGGATGTGCGAGTGCGgctcgtccttgtcgttctcgGTGTTGACAGCAGATTGTTCAGTGTCCTCTCCTTGAGTA
CCATAGTCTCCATTCTCCAGCTTGTGTGAGTGTCCATTAGGCTTGGACAGACTGTCCACCTCTGCAGCACGCGTGACCTcgacagccagcagcgcgtcgc
gCTCTTGCTCGGCGCCATGGGCGTGACCGACCTGGCCGTAGTGCCGTTGCAGCGCGtgcgccagcacctcgaTCAGCAGAACCATGAGGAAACCGCAGCC
GTAGAAGAAGTTGGCCCATTTGAAGCAGCGCTTATTGTCGCCGTCGTAGCGGGTCCGCACAGCGAGAAATACCTCGGCCGTGTGCTCGCAGCCCCATTCT
GTCAGCGCCGCGTTGTTCTGCGCGTCCGGCAGCAGGTGCATGCACGAACTGGCGAGGAAGATGCCGGCCGCCACCATGTTGagcacgctgctggcgcgcT
TGCTCACGCGCTGACtgctcagcagcggcgcaATGCCACCCACGACCGCCAGCGCCCAAATGAAGAGCGCCGCGGCCAATTTGAATTTATCGACAGGGTC
CATCGCGCGTCGTCCGAGAGGTGCAGAGGTCGTCTCGACCGCTTTGTCGCGCACAAGAGGAAATCGCAGAATGAAGAGCTGCCAACGCTCCCAGGCCTCA
GACTCAGAGGATTGGCACTTCGCCGACGGCGCCTGAGATCTTTCTCTGGGCTTTGCAAGTTTTCaggtgcttcttctcgtcatACTTGCGCGCGAAACAG
CGACCACATTTCAGGCATAGATACGGCTTCTTCCCCTGTAACATACGTGTAGCTGTCAGAACAACCAACTCACCGCTCAGGAGAAGCTAATACTTACACG
TTAGTGCGTTCGTGGCTAATCCTATCCGAGTCTCTCACGAAACACACGCATACTTACACCGAAAAGACTTCTCGCCTGTATGCACACTGCCGTGCCCATA
CAGGTCAGCTTGACGCAAAAAGCGTCTACCGCAAGTACTGCAAGTGAGCTGCTTGTCGCCTGAGTGGATTTTGCAGTGGCGCTTGCGGTTGCCCTTCAAC
GTAAACTCGCTGTTGCAAATCGTGCATCGGAAGCATGCGGGAGACTCACTGATTGGAGGCGTGGCGGGTATGAGGAGGAGCAAATCCTGCGGAGGCAGCG
AGTTGATTGTGTTCAGGGCGACTGCAAAACCTTCGCAATCGCCCTGgagttgagctgctgcgcgagcTGTTGGCAAGACCTCAATCTCGACGTCCGGCCT
CGATTTTTGGTGCTGTAGGCAGGTGGTGTGACGACTGACTGTCACGACCGGCGGGACTGAGGAAGCAACAACTAGAGCGAAGATCCCAACGGGAAGCTCG
AAGAGTCGTAGGGCGAGGGTCTTGGAAGGAGGCGAGGGTTCAGGCGAGAACCCGAGGCTTGGGTCTTGAGAGAGCTGGTTGGTTGCTCCGAAGAAGGTAC
attggaaagtgagattGACTGTTTTAGAGCTCAGAGAATCCTGGTTCGTTACACACCTATGTCTAGCTAGTCCAGTCCTCTTAACTACTTAAGCTACGTA
TAAATGATTCTTGATCGTACTTGGCTTGAATCTTGGAGGTACGCTAGTGTAGGCACCGACCGCGGTTCATGTNATTTTCATtatcaaatacaccaactac
cccgcactcgagaccaactcctacctacgcgacctacactctgactctaacttcaacgaccaacactcttcactTCAGTCACGACAAAATCAATATAAAC
AGAATGTATGcattgaagttgaagctgctagTGCAACCTGGGGCAACATCATGATGTTGCTCCAGTTCGGCACGTGGCGGGCTGGCCGCTCATTGGCCTT
GCTCACAACAACCGGCGTCGTGGCAACCTTGGCCGTGGCGCTGGTCTGTCGTTGCAGGTGGGCTCCTCAAGATCGTcttttttcttcctcttcttcttct
tgcggccTTCATCTATGATACTTGTCCTGAAACCTTTGCTAGGAGGCTGCGCCTCAGTAATATGCACGCCAGCTCTGCAAGCGGCCTGTATGGCTTCTAT
GTGCTTCAGCGCTTGTGTGCGATCGGTCGTAACCGTGCAGCTCTCATTGTTGCGTGGCGTATCTCCCTCCTTTTCGCTCAGAGCATTTACTGAGAGATTG
AATGACCCGTCAATAATTATGCGCCCATCACAGATCCACTGCTTGGAGTGCTCCATAGCGTTATCGATCAGCGTGTGCACCTCCATATTGTTTTCCAGCA
AATATTCGTAAATTGGATGGTAGTTCTTGTCCCACATTGTGTGCTTGTCTGCTACGATAACTACATTGACGCCTCTAATTTTTGCTGCTACAATTCGTTG
AGCTACCCCTATATGAGAGAAATAAAAAGCTGAAATAAACATCGTATCGTGAGTATTGTCAATAAGCTTGTGGGGTAGGATCAATAATGGAAAATGCCAT
CCCCAAGTGCCGGTGACAGGCACATCACGAAGCATCAGCTCAAGCATGATCTGGTCGTGATAGCGCTTGAAGGCGTTATcggcagcttccagcactGCGC
TTTCTGCATGGCCACAGTCAACTACCTTCTTCCCCAGCACCTGGGTAGCTGCTGTGGCAAATTGGTCAGCGAGCGTAGCAATCGATCGAGTTTTGGGCCC
ACATCTTGGTTTTGGTGTCCCTCtgtggagatggcgagtCGATCTTCGCCAGCTTACACAACGCCTTCAACGCTCTGTGTGTTGAGTTGCATCTGGATTC
CGAGTCCGGTGAGCTGTTAGCCATTTTATGCTCTGCACGTCTAACTGAGAGAGGGTTTTTTCACCTGCGGGTTTTCCTTCCAATCCCAATCATACCTCGT
GGAGAACAAGTGTCTTTCTTCTGAGTATTCTCTCGTGAACAGTCACTCGCTCAACCTCTGTAGTGCTACATCGCAACACCCTCTCTTATTGAACCGGTCT
TCTATGATGCGAGGGTTGCATCCTGGGAACTGCCGCGCCACTGCGTGTCTGTCTCAGGGCGTCAGGATCCCTGTTTGAAGCGCCGAGGTCCGACCAAATT
TATAATCACCAAAATCTAAAACAAAGCCGTGCTTTCGCTTGGAACAGCTCTGGATTTTACAATTTAGATGGCAAAAAATTGCAGTGCAATCAGCAGCTAG
CGTTCTAGCGCCGTCTCAAGCAACTTCCATCCGAACCAAAGCAATCACCCAGGTACACGTGGACGCGACCGTGTTGCTGGGTGTCGCGGATGACTGTTTT
GCCGCCTCAAGCAACTGCAATATCGCGGCCAATGAGCCGCTTACCAGCATAAGCCGCCAGTGGCAATAGTGCTTATattgccaccgccacgcttgctttt
tgtatgtACAAACAACCTCCATTGCGATTGGATAAAATCCAGAAAACTTATTTGGTCCGACCAAATTTATAATCATTTTTGGACCAAAAGACGCGCCAAC
GTGTTCGCAATGGAGTTCCTCGTGCCGCTGCACGCGGCGGAtctggagctggccaagacggacCGGTACTATGTGCAGTCGGTGCAGACgttcgagaacg
agacggcggcggagaTCTCTGCGCGTGTGCAGCGTCTGGAGGACCAGGTGCTGGGCAGTGAGGCGGGGCTGGAGCTACTGGAGGAAGAGCCGATGGACCT
GACGTACAGtctcgtgaagaagctgccgacgctCTCGGAGGCTCTGAGGATGCGcgtggtggagatgctggcggCCTTCGTGAGCAACGTGACGGAGTTC
GTGCTGGCCAGACGGCCAGGCAACGATGACGCTGAGGACGTGGCGCAGTTCCGCAGCGCCTTCAAGGCCAGCGTCTACTTTCTAATCACGGCGCTCACGA
GTGTCAGTAGTTTACAGCTACAGACAGAGAAGGACATTATCAAACATAAAGGCAGGAAGGGACAGGGGGCGTCTGCCATCAACCGCATCAACTGGAGCAA
AGTGGTGGAGGGGGCCATCCACAAACTCAGTCGTTCCGTCAGCCCAGCGACCTTTTGCATGTGGAATATGAACGTACCAGAGGAGGTGCGTGggcgaggt
ggagcagcagttAAAAGGGGGAGACAAGTCCTAACAAAACCTTGTGATGTGGTGTCAGGAATTCTCGATGCTGTACTGCAAAGTGGTCTTCGAGCTGTTG
GGCAACGCCTTGCTATGTCGCGGCAAGTCGTTCAAGCCCAAGCTCTATCATGTGCGTGGCGCTGTCCATCACGGGCTTTGATGTGACTCAGCTTGAGACT
GACTGCTGACTGACTGGTATTTGAGATGCAGCTCCTGGCGATGAGTCTTCAGAAGGCGCCGGCTATCCACATTTCCGTGGTGGCCTCGCTCATCGACCTG
ATCTACACACACGAGCACCTGAGCGCGTCCATCGCGGAGCTAGTAGAGCTGGTCTACTTTAAGTACGCCAACATGACGTTCGCGGCGGATCTCATCAGCG
AGATCGGAAAAATCTCCTCGCGGGACGCGTCCAAGGACGTGGCAGGAACGCGAAACATCGCCATGTTTCTTTCAAGTCTGTCGACTCTCACTCCGGCGTT
AATCATGGGGAATCTGAGTTttgtgctggcgctgctcgacTCTGAAGCGTACCAACTCCGGAACGCTGCTGTTACTTGTGTGACGCAGATCTTACTCTGG
AACTTCCGACAAAATGGACAACAAGAACCTgatgatgctgcagcagcgactgggACTTCAAAAAAGAAATCACGGAAGCAAAAAAGGGATGACGAGGAAA
CGAAGAGCGACGGGTCCGACAGTGACAgtagcagcgatgacgaagatggcaGTAGCAGTGACTCGAATGACGAAGAGAATGCTACAAAGACCAACACAGA
AACCCCGCGCACATTTTCTCGCTCAACAAGAGATCAGCTACTCAGTGTGCTTGAGGATCGCACCCACGACATTAACTCCTTTGCCCGGGGTCATGTGCTG
AAAATGTGGGCTCTTTTGTGTGAGGAAGGTGCTCTACCGCTGCATATGCTCAAGAACGTGACCTTGATGGCTGTAGGCCGGCTACAGGACAAGGCCGCGG
TGGTTCGCCGCCACAGCATTCACCTGCTTTCATTGCTGCTAGAACGAAATCCTTTTATGGGCAACCTGGATCGTGAATTCTACGCGAAGAAGCGTGATGA
GTTGACAgaagagatgaagaagaagcgtgaTGAAGTGATTGCCGGCGCAGAGAAGGAAATGAGCGAAGCTATGGGGGGAATTGCTATCCAGGGTGAAGGC
GATGCGGCGCCTTCATCCCCTCAACGAACTATCTCtttggaagaagaagccgctgcgCTTGAAA