Description :
From Genome Similarity Track
Location :
Scaffold_664:11332- 12376
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_664-snap-gene-0.12Endomembrane protein 70

Sequence
1044 bases(100 bases per row)
ACATGTAGCCAAAGTAGAAGCAGGTTTGCAGGAATCCCGACATGTTGGTCTTGAAGAAATAGAAGTAGATCGCGTAGATGAACACGTAGATGGCGGTGCT
TCCGGCGGCCGCAAACGACGTCCAGTGCCACCGGTAGTTCTCCGAGTTCAGCAAGAAGTACGTGCTCACGATGGTCACACACAGTGTCACGATCCCGAGA
ATCAAAAACACCAGCAGCATGAATCCGTACACGTAGTAGAACTTGTAGCTCCAGAAAGACGCAAAGATGAAGTACATCTCGATGAAGATCGACCCAAACG
GCAAGATCCCGGTGAGCATGATCATCACTGGCGGACGCAGGTACCATCTCGCTTCTGGGATCTCACGCGGAAACTTGTTCACGCGGCATGGGAACCCGCT
TTTCGCAGCGCCATGGCGGCCGAGAATCGTGCCGAGCACCGCAAGCGGACACGAAACGAAGAACCACACGAGAATCACCTGCACGATGGTCACGAACGGG
ATGGCATACGTTGTCCCATACGCAACGGCCAGCGCGTTGATGAAAAACACGGTCACGAAAATCACAGTTGGAAGCAGCGCCGACGACAAGCACATCGCTC
GAATCCAATCCTTTGACACGCGAGGGTAGAAAAACTGGTGGTAAAAGGCGCCACTGGCATAGCCATTCGCGAGCGACGAGAACGCGTATACCGTCAACCC
CACGGACACGATTCCACCAGGTTGCATGTACAGTGAAGACACGATCGCAATGAGAACGACAAAGATCGAAAGCACCAACAGCTGTGCACCCGTGCCGATG
AGCGCGCAAAACAGAAGCAGATACGGCGGTGCGCGGAACACGTCGCCATGGAGCAGTTTCCATCCAGAGTTGGAGTCATCCTTGAGCAACGAGCTCTTGC
CGTCCATCATCAGCTCTTCCGCGTCATCTTCCGCAAACTTGGCGTAATCATTCTTCAGAGTGCGCAACAAGATCAACGCCACAAGACCGCACAGGAAAAT
CACCATCATGAACGAGTTGAAAATCGAAAACCAGTGAATCTGGT