Description :
From Genome Similarity Track
Location :
Scaffold_606:11331- 12372
Transcript NameFunction/comments
Phymu_g11114hypothetical protein PHYSODRAFT_327292

Sequence
1041 bases(100 bases per row)
CGTTCGTTGGTCAAGTGTGCCGTCCGATCTTCGCTCGTTGTTATGGAGTCGTGCCGATGACACTGCAGCGCTATAAGAGACGCATCCGCGACGGCAACAT
GGCTATCAAGGACCACAGAAACAAGCTAAACAAAAACGCCTCACAAGTTGACGTGGTCTGGTTAGTGAAATGGTTCACTGACTTTGCCAAGGAGGTCGGA
GAGGTGGTACCAGTCCGCGTCCGTACGCAGAAAAAAAGTGAACGGAACTATCCAGAAGAactacagcagcgacaagTACACTTTGCTTCCGGCACATTTT
ACCTGGGATACCATTTGGGATGAAATGCACAAGTTCGTGGAGTGTGGTCTGAGGGTGCGTGAACCGGCGCGAGCCACAATGAGGAAACTGCTGACACTAC
ACTGTCCTACGATACGGATTCGGTCCGCGCAGCAACGTCTGTGATGTCTGCGCTATTTACCAATCTGGAATGCGGGGCGGCGCCACTGCTGATAAGACAG
AGGCTTTTGGCAGCCACACTGAGTCTGCTCGTCGTATGTGGTAAGTTGTGGGTAGGAGTTAAGCAACATTTTGATTTGCTTAGTATATTCTAACGGGATA
TTGGTAACATTTTGAATTATTTACAGACGCGAATACAAGAGGGATAaggcttcctgctccagcgaaCACGCAGTCATTGTTATGGACTACTCCCAGAACC
TGACGATACCCAGCGTGGCTAACACGCCTTCTCAATGGTACTTCTGTTCGCTGGTGTCTGTGAGTTATTTCGGGATTAACTACGAGAAAGATGGTGTACA
GACAAACTACGTCTACGATGAAAGCGCCAGCGGCAAAGGTAGTGATCAAATCAATTCGATGCTGGCACACTTTATCGAGAGGAATCTGGTCCCGTCTGGG
AAAACTAGACTGACTGAGTACACGGGTAACTGTTCGGGCCAGAACAAAAACAACTACGTGATCAAGTACTTCCTGACTCTCGTGAACATGAGCATTCTGG
AGCACGTCGACTTCAAATTTTTCGTGACGGGTCACACTCGG