Description :
From Genome Similarity Track
Location :
Scaffold_23:113287- 114534
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_20158Hypothetical protein

Sequence
1247 bases(100 bases per row)
CGGCTGCACGGAAGGCCTCGCCCGCTTCTACGCCGCCGACATCGTCAACGCGCTCGAGTACCTCGCGTCGCAGCGCATCGTGCATCGGTACTCTGCCGCC
ATGTTTACTTTCACATAGTAACATGGATCGCGTAGGGATTTGAAGCCGGAAAACATGATCGTGTCCAAGGTTGACGGCCATTTGCGGCTCGTCGACTTTG
GCACAGCCAAGAACCTCTCGGACCCGGCGCTGAACGGCCCCAACTTTGTCGGGACACCAGGTAAAGAACGCTGGTAGGCGATGGACCCGCCCATCGATGC
GCGACGATAGAGTACATGTCGCCCGAGACGATCGCCAACAAGCCTGTCGACACGAGCAGTGATCTCTGGGCGCTCGGCTGCATCGTCTACCAGCTCCTGA
CGGGCGATACACCGTTCCAAGGCGGGTCTCCGTACTTGTGCTTTCTTAAAGTCCAAGACGGCGTCTACGACGTACCGACCTTTTTATCGGCGCCGGCGCG
CGACCTGATTGCGGCCTTGTTGCAACCCGACCCGAGCCGCCGACTTGGCGCCAACGGCTTTGACGCACTCAAAGGTCGTCGTCGCAATGGCCTTGTCCAT
TGATCGATCGCTCACGATATACCGTGTAGCTCACGCGTTCTTCGATGGCATCAACTTTAAGACGCACCTCTCGACGTCGCCGCCCTTTGCGACGCTTGAA
GACAAGTTCATTTTCGAGTCGGCCAAGCAAATCCACGCCTACGTGGCGGCCGGCGGTGGCGACAAGGCGCCCGCCGTCTTGGCTCAAGCCGTCGCGCTCG
CCCACCCGCGCAAGCCGCGCCTCATGCACGTGCTGAATCGCATGCAGCTGCTCCAGCACCCAGGTACGTCCTCGACTTGTCTTCCACGTCAGTCACGCGT
AGGGCTGTAGACGTGTACCCACGCTTCTTTTCGACCATGGGCCTCGGGCGGTGTCTGTATGCGACCAAGCGCGGCTACGTCGGTCTCACCCACAGCGTGC
AGAACGAGTGGAAGCAGTCGTTCACGTTTGTACATGTATGTTGCTGGGACCGTTTCTACGGCGTGGTTCCAAGAGCGTGCGTAGCTGTCGGGCCCGTCGC
TCGGGAGAGCCGCGGCCGCCACCGAGAATGACGGGCTGGGAGGCTCGTCCTGGGCGACGGAGCTCGCACTCTTCCGGGACGCGCTGCTCGCACTCAACGA
GACGCTTCCGACGCTGCTCGTGCTCTCCGGCAACATGACGCACGCCT