Description :
From Genome Similarity Track
Location :
Scaffold_89:11323- 13404
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_89-abinit-gene-0.96Novel protein
Pytve_DAOMBR484snap-pve_contig_89-abinit-gene-0.132PERQ amino acid-rich with GYF domain-containing protein 2

Sequence
2081 bases(100 bases per row)
CTTGCTGGCGGCGACCGTACCGCGATTCGTCCAACTACAGGCATCAATCATAGGTTTAGGAAGGCGAATCACTGATGCAGTCCGCGATTGCCAATACCTG
AGGTCGGAACGGATCTTCTGGCGGTGGCGTGTCAGGGAGCAGTCTAGGCGGGCTTGCAGACGATCGGTCATGACGCTTCTTGTCTCGTTTCGACGCCTTG
TACTCGGCTGCATCAACTTGAACATCCCGGCCGAACTCGTCCTTGACGAACACGAGCGCGTCGCGCTCCTTGTGTTTCTTGCCCTTCTTGTCCTTCTTCT
TCTCTTTCTTCTTCCTCTTCTCTTTCTTCTCTTTCTTCAACGACTTGTGCTCTCTCAATGTCTCGTGATTGAGCTCGATTGGCGGCAGTGTGGAGATGAC
TGTGATGTCATCGGCTGCATCAGCGCTGCTGGCAACGCCTTCAGAAGTGTCTGCTGGCTGAATAATCTCGCCTCTAGCAAGCGAATAATCCGCATACCAT
GGAAAACGCATAGAACGAACGTCAGAGCCAGGCATCGACCTTCCATCAATCGGCCAACAGAGGCGAGCGACGAGCAGTTCCGCACCGCCAGTTGCGAAGG
CCGCTCATGGCGCCGCTCGTGGCGACAGGCGACGATTGTGATGGAGATATGGACATACCCCAAACTACACATGTGAATGATCCAAACACAAAAGTATTGA
CCATGGCGCACTTTGACATGCATGCACCAAGAAACGATCCGAGCTGTCGTGGCAATCTCACGAGATCCACGATGCCTCGCTGGCTGATTTGGTGTTGGCT
TCGCAGCCACCTCTGCGGTATTCCCCGCATGCAGGTGCTCGCCGTCGCCACGACATTTGTCCATGAGAAGAACCGGTTCAATGCACGGATCTAGCGGTTT
ACCGCGGATTTAACGGAGTGGTGTCGGCATATCCCACCGTATATTCGTACCACCACATGCGGACTTATCCGAACAACGTACTTGATCGCACCTCGACAGT
ACTCGTTCCTCAAAGCGAACCGCAGCCGGCGCTCACCGCTCCTCCCCCGCCGCCGCTGAAACAGCAAAGCCCTGAAAAAGGAAACGAAGCACCTCCGCTC
TCGGGCTGCGTGCCACCAGCGAGCAGTCCTCTGAGCCTCTGAGCCTCCTCGCCCCCTCCCCCTTCCCGCCACAAGAGGCCCCACCCCCGCGCCTTGCTCT
CCCTCCCTCCTGCTGTAGCAGCGCCGCACGGGAGCAGCGACGAGCACCATGATGTCGTCCGCCAACAACAACGACGACGACTTTGTGACCAAGACGGCCA
AGCACCGCAAGAAGACGAGCAACAACGGCAGCGACAATACCCCTAAGAAACCCCCGACCGGGTCCAGCAGCGGTACTTCGTCTACTACTCCTGCTGCTGC
TGCAGCTGGTAGCAGCACTCCCGGCGCGGCGCCAGCTGCCGGTGGGGATAGCATCTCGCTGCGACCGCGCACCATGTTTGCGATGAAGGGCCGAGGACGC
ACCGAGTCGGAGGGGTCGGCGTACCGTCCGCAATGGTCGAAGGACGGCGAGGGATTCGTGTCGGCCTCGTCATCCAAGGATGCGGGCGGCAAAGACGGCG
ATCCAAACTCGCGCCGCAAGAGCAAAGGTCAGTGGATCGGTATCTTTGGTTGTATGGCTGCGGGATCCTGACTTGGTGATGCGGTGGGGTGTTGTAGTGC
TGCGCTACACGAAGGAGGAGCTGTTGGCTCTCCATTTCACCACCACGAGCCCGCCCAAGTTCCCTCCAGACACCCCCGTTGCATCTGAGCACGCGCTACC
GCCTGTCGGCACGCTGCCGTTCGACTACGAAGAGATTTATAAACAGTGGTCGCTCAATCGTAACCGCGGCCGTGGTCGTGGACGCGGAGCAGCAGCGGGC
AATAACCAATCGTCACGTGGATCGCATGACCGTTCTCGAGGTGACGGCAAGGACGATTCCGAGTGGGACAAGCACGGCAAGGTGCGTCTACATGGGATCG
CCAAGCTCGTTTGTTTGATATGTGACTGATCGTTGTGGGTTTTGTGCCGATTGCTGTGTTGCAGCGAGACGATGGCCAGCA