Description :
From Genome Similarity Track
Location :
Scaffold_2:1132061- 1146629
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G000773Similar to ODA11: Dynein alpha chain%2C flagellar outer arm (Chlamydomonas reinhardtii)
Pytul_DAOMBR144PYU1_G000772Similar to ola1: Obg-like ATPase 1 (Danio rerio)

Sequence
14568 bases(100 bases per row)
TAGTTGTCGTCCTGGAACAGAATTGCAACGCCACGAAGCACCCACTTCTCGCCGCCGCAGTCGGTGGGCAGCGTCGCCAAGAAGATGTACGTGTGGCCTC
GGAACCGCGTGAGGTACACTGGGCATTCGTAGATACTGGGGTCGTGGCGCAAGTACCCGACAGCCGAAGGCTCCCAACTCGGTTTAGTCTGCACGGCCTT
CACGTACACTACCGGCAACGTCCAGAGCAATTCCTTTGGATTGCTATCGAGCAACGTGCCTCCACACTCGGTCGACGGGGAGGAGCCGATGTGGAATCGC
TCCGAGATCTCGTCCAGCGTACTCCATCGAGCGCCTTCGAGGATCAGGCCGTGGGCAAACACGCCGTCGTCGGGGTAGTACGTGACCTGCGACAGATCCT
GGAACGTCGTCACGTGCGTTTCGACAGTCATCTGGTTCAACGGCATGAACTTCTTTCGCGACGTCACCTGGAGACATGCGGTGGTGTACGCAGTCGGGTT
GAATAAACCGGGAAGCCAAATCGAGAACGGCGTGACGAAGTCCGTCGACCAGACCTGCATCTGTTGGTAGCGCTTCACCATGTCTGTGAACCATCCGCTG
AGCGATTTCTTGGACGGCCAAGCTTTCTTTTCCCATTTGCATTGCGAAAACGGATTCCGTCCAGGCACTTCGTTCAGCGACATTGCCGTGGCGAGGTCTT
CCATGGCCTGCGACATATTGAGTTGACCATTGAGACCCTTTTTCAGATCCCCCAGGGAGATACGAATTTCCTCAAGCAGTACGTTCATGCGGCTGCATTC
CTGCATCGCCACGACCACGAAAGGACCATGCTCCTCAGTCAGCAACGGCGTCGCGAGTTCAGTGAGGTCGAGGAGACTGAAAAACTCTGGGCACCGCGAC
TCAAACTCATCGATCATGTGCCGCAGCGCAGACGTCTTGTCGCCGCCCCCTTCGCCGCCGCCGCTAGCTCCGCCACCGATGGTCACGATCGTGTAGCACA
ATGTCTCGCACGTCGTCGTCAAGTAGCCGATTTCAGCGTTCGGATGCAGTCCAAAGAGCGGTGGAGCCTCCGGTACCATGTTTTTCTCAATGTAGTTCGC
GTACTCTGCAAAGTTGAACTCTTCCGGGTTTGGCGACTTGAAGCCAGGCCCGAGCTCCATGCCATTGAGCAGCCCTGGATTGATCAGCACGGTCAAGTAC
GTGTTGTTGGTGCGTCGATCCCAAGAGTCCGTGATGTGCCCGCCGTACATGATTTCGCCAAAGATATACCGCAAATCGTCCCACGGCACGCTCGGGTTGT
TGTCCAAGTACGAGTGCAGGATATTCGCGCAAATCGTGAGATCGCCTGTGTTGAAACTGTACGCACGACTCCAACCTTGTTGCCCAAAGCGGCGGCGTCC
GAGCACGATCGCATGGAACCAGCACAGCGCAAACAGACACGCTTTGAAATCCGAGGGTTTCGTGCACGCCTGAACTTTGTCTTCGCTGAAATTCGTCCAG
GCGCGTCGTAAGTTGGATTGGATATCCGACGGCGCTTCATTCGCGACCTTGATGCAACTCTGCATGAGCGACTCGGGAATATTGAGCATATCTGGGAGCG
GTGGGGGCTCCGCAGAGATGAAACACCGAAAGTTCTCATGGGCACCTTCGGTCGCGACTTCTTCCAATTGGCGTTCCAGTGTAGGCAGCCAAGATTGCAT
CAAGTGCACATTTTGGAGAATGATCCATCCGCCATCCGTTGCAAGCTTCTTCAGGGACTCGCCTGCGTACGCTTCCTGGCCTTGACCCATCGAGATATTG
ATAAAGTTTCCGTTTTCCAGACTAACACCTTTCGCACGTCCTAACTTTTCCACCCACGGCGTCGGATCAACACCAGGAAACAGCACAAAGAAAATCGGGA
TCGACGAATTCGTTTCCTCGTACGTGGCCTCCATGTTGAAAGGAGGCTGACTCACGTACTCTTCTCCCAACGAATCCAAAATGAACGTGCGCAACGCGTT
CGTGACGCGATCCGGACGCAATGCGCGTAGCAGGATCATGCGCTGGAAAGACGAGAGTTTAACGAAATCCCCAGGAAGCTTCTGTCGCTCTGCGTCTTCC
GTGGCAAACCATTTCCGCCATTCATCTGGATCATTCTGGATCGCATCGCCTAATCCTTGGAAACACTTGAGCGCCTCGAGTGCTTTGATCTTGGACCAAA
GCGCCGCAAGAAGCCACTCGGAGGCTGACCCGGCATTCCCAGCATCAGGATGCGATTTGCTGATCAAGAGATACTCGACTTCTGAATCTGAGAGCAAGCC
GTCTTTCAGTAGGATCTTCAATGTGAGCATCGTAGCGACTGTGAGTTTGTCGCGCTCAAATAGCCCACGACGCACATAGTTGTACACACACGACGTGATA
CTGTCCATGAGGATGCGGCAACGCGCCAGCATTTCTTCATCCGTGAGGTCGGGCACCTCACTTTCACCGCCTCCTGTGCCAGGAGTTGCTCCTTCTTCTC
CTTCGCCGCCGGCAACAGGTTCGCTCTCAGGATTCTTGATCGGAACGCGATAGATGCCAGACAAGAACACTTGCTGGAACGACGCCAACGAGTAAATGTA
GTACGAGTGCACTTTGCTGATATCGTTCATCAAGAAGAAGAGCAGTGAGCCGCGGGCTGCGATGCTCCGGTACTTTTCACTCGTGATGTTGACGGATTCC
TGGGTCTTCTTAGCCGCCTCCATATTGTTTTGCGTTAATTGCGCCTTGTACTTGGTGTCACTGAGGATACTAATCAGCGGCTGGTTGTTCGTGATATCAT
CGTCAGCGCTCGCCAGGTAGAACAAGATATCATCTTCGAGCTTCTTGAGCTCGATTTTTCCGTTGTTCTGCTCCTGGATGAGTTTCTCTCGCTTCACAGC
GAGATCATTCCGCTCCTTCGACACGACGAGATTCAAAAGCTGGTCTTCGAGACCGAGAATAGTGACTGTGAAGTTCACTATCGTGCATTCGGCCTGGATT
TCAGGAGGATAGTGCGGATTTCCCAGCTTCGTGTGCAAATACAGGTGGAAATTGTCGTTGTACGGCACTGAGGCATCTCCGATTTGGATCTCGTACCGAG
CACCACGTCGAGATGTCGACCGCTGAATCACGGGCGCCAAGATTGGGTCAATCTTCTCGCCCAAATTTTCGATCAGGAATGCACCGTCCGTGCCGATCGC
AGACTTTAAGCGCTCGATCCACATCTTTTGACCAACACGAACGATGATCAGATTATTGTGCGCTTCCATTTCACGAATCCACGCAATAGCTTGCAGCTGT
GGATCGATGATCAGTGGACGACGACCCATGGTCACAGTCGTGACGACGATGGCGCCATTTTCGGTCGAGACACGATCCGACGGGAGCTTTTGCGTGTTCC
ATTGCGCGATTTGCGCATCATCGGTCAAAATCGTGAGTGGGTTCGATTCCTCCGACATTGCGATACTCTCTCCATTCGCAGCTTTCCGCAAGAAGGGAAC
CCAGTGTTTGTTGATCAGCTCATCACGGAACGGTTTCGTGAATGGTCCAATGTATGAGATAAACGCCGATGCCAAGAGCACATCGCCTACGAGCAGATCT
TTCTCCTTCTGTAGTTGCAGTACATTAATCCCCCAACGCACATTTTCGCTCGACAAGTCATTCGTTAGTGTCCCCGCAAGCTTCATCTTGCGGTTTCCTT
GCTCCACTGAGTTGATCGCATCTTCTTTTTCTTTCTCTGCAGCAGCAGCTTCTTCCAGCAACTTGTCCAATTTGGCTTGTAGCTCAGCGACAAGCGTCGT
GACTTCATGCAGGCGCTTGTTTGCAGATTCTAGTTCCAAGTTGGCGGCCGCAAGCGCTTGTCGTTTTGGTTCGACCGTGATCAAAATATCGTAGTACATG
ACAATGTTGACGACCCAGGAACAGAGACCTGCTGCTGCCTTGTTTTTTGTCAAAATGGTATCGTAGTTGAAGTGTTCTTTTTCCAGATACTCACGCACAT
CTTTCCAATTCACGACGGGCACTTTGCCTTCATCGACGACTTGCTTGAACCCGACTAGGTAGTCGATGTACTCAGGGATGTTACCCAAGAGTTGCTTCTT
CACGGTATCCCACTTGGCATCTTTCACTTTGCCCGCTTTCGTCACCTGCACATTTGGATGTACGCCCGCGAGCAGGACCATGGTTGCGGCGAAAATATCG
TCGACACCTGCAGGTGGCTTTGACATTGTCTTACATTCGCCGAGATCTTTTTTGTTCAGGGAGTCGAGCGCAGCCATAGCTTGCTCGACAGCAGGCTCTG
CTTTGGCGAGATCTTCCTGGGTCGATCGTTGCTTTTCGGTGACTTCGGCCTGGATGATCGCACACTTGGCGGCTTCTTCACTTGCTTTCTTACTCTCGAT
TTCGACGTTCGCCTTCTCTTTGTTGACCGTTTCAGCGATCGCTGAGGCTACTGCTTTTTTGTCTTCCGCGGCTTCAAGCTTGCCTTTCAATTCCACTTCG
AGGCGTGCTACGGTCTCTCCTGTTTCTTTGAGTTTCTGTAGACCTTTCTCCAAACGCTCGATAGCTGCACCATACTCTTTCACTTTCTTACGCAAGATCT
TTTTGTAAAGTTGCAATAACTCCAAGTACGATTTCGGGGTCGTGTACACGTACCGTCGCTCCACTTGGAAGAAGCGCTCAGCACACTGGTTGACCGATTG
GAACGAGAACGGCATGAAGTTTTCAATGCCGGTGCGAGAGTCGTCCGAGCCCAACAAGTCGGAAATTTCCTTCAGCTTTTCACGGCCGACCGATAGGAGC
GCTTCTTTTGGCCATGGCTGGAACCAGTCAATGACGGTACAGCTCACAAGCGCAGGGAATTTGCGTGCGCGGCTTCGGAAATCGTCGCCCACGGGAGAGA
AACACAGACATAGGTGTAGGCGTTTACGGATCTCGGCCTGAAAAAACTTGACCACCTCTTTCCGGTCTTTCGTGCCAGCGACAGGAGACAGCAAATTCAC
AATATTGTCCATATCTTCCATCGCAAACAGGTCTGGAACTTCGCCCGAGGCCAGCAGATCGTTCAAGTAGATCAAAAACTTTTCGTTCGTGATCTGTGAA
TCCGTGAGCATGAACACAATGCCACCATCTTCTTCATTACGCGAGAGCATTTCGACGACATTCATGTGCATTTTCCGCAGATCTTCCTTGAATTCGTTCT
CACCGTACTTGGAACTGATCGTGATCTGACGTACGAGGTAGCCGCAAATGTGAGACGCGAGTCGTGCCAGCGAACGTTTACCACTTCCGCCGACACCGAC
GAGAAGCGCGTGACCGCTTTCATTGCGCAAGATACGAACAATTCGCGCCACATGCTTCACGGCATCGTCGAAGAGATCCAAATGCATTGCCGTATTGTTC
TCGTTGTTGTTGTAATCGCGCAATTGGGCCTGCAGGTTCATCTTCAAGTCATCGAGGTTCGTGCCCATGATCTGGTCGTACTCTGGGTCACCATCTTTCG
TGAAGTGACAGAAAATCAGCGGCCACGAGTTCTCGGCAGCGTAGTATCGGCTAGTATTACATGCTGGGAACGATCGCTTTACTTGAAGCTGCACGAGCTG
GTTGTACTTTTCGATATCTGCCTTGCACACGAGACGGTCACCGTAGACACGCTCGCTCTCATGCAACCAAAGCAACACGAACTTCTCGGTTGTAGTAAAG
CGCTGCTTCTTGGACGCGATGAGGCCCTGGAACACGTTCGACAAGTGCCGTACATTAAATTCGTAATGGAAGTTTGCTGCAGTCTTGCGGAATGTGTTCA
CGACGCTGGTATGAAGGCTCAACGCAGCCTTGATCAGCGCGTTCGAGAACTGCACGTTGCTGAGTTCGTCGCAAAAACTCGACAAGTGACCGCCAAGAAA
TGTTTCGTAGATCGTCACGAGACTTGGCGCTTCGGGCATACCCATCGCAAACGTACAGAAATGGCGTTGCAGGCGAGGATCAATCAGGAACGAGCCTGCG
GTTGGGTTCATTCCTGCGACGACCTGGGTGTTCAGGATATTCTGGGTTTGCAGCTTTTGACGGTCAAACCAGTGCCTATACTCCATGACTTGACGCAGCA
GCGAGATCGCGCTCTGTGTGTTGTACGGATCGACTTCCGGCAGATTTAAATCATCCATGAAGTAGATCAACTTGGTTTTGCCTGGTGGCCCCAGGTTGAT
GCCCGTTTTGCGCTCTAGTTGGCCAAACATCGCCTGCTGCAAGATCCCCGAGGTTGTGTAGAAATTAAAATTGATTGTGCAGTACTTAAACGCTGCCGTG
GCTTCGTCTTTGCTGAGCTTCTTGAGCATTCCGACGATGTTTTGCGTCTTACCCGTACCGGCGGGACCACAGACCATAATAGGAATACTCTTGTTGATCA
AATTCTCCAACCAAAACGCAATCGAGGCCGTCTCTGTCGTCGGCACCGTGATCTGGTTAATTGGGCTTGGCGACTTGTACGTCTCAGTGTAAAAGTAGGG
ACTTTTCGACCAGGAATTGAACTTCGACGTCTCCGGGTCCAACCAGAAATCAAACACTGTGTTGCTCGCGGATGCAACAAGCTTCACATCCTTCCACTGG
TTTTTCCACCAGTTGCTGAACTCGGCCGAGTAATCGGTACCGTCGTCGCTCATGGTTAGAATCGACCCAAACGCCCACACGCAGCAAAACACAAAGTTGT
TTTGCATCACCGTGTAGTCCTCGAGCACATGCGGGGTCAATAAGCAGTCGATCATATTGAGCAAGTTTGTGACCAAGGTCGTGTCTTCGACAGGCACAAT
CGGCACAAGTTTTTTCTTGAAGAACTTGAGTGTTGGTTCAATGTACTGGTCGAAGAGGCCTTGAAATTTTGCTCGAATGTCCGGGGTGAACATCATGTTC
TTCAGTCGATGGTCATGAGGCACTTGGCAGTGGCGCTCGAGCCAACTATCAATCAAACACCGCCACTGATAACCTTCAGAGGTCGAGATGTACAAGATAC
CAGCGCGAGAGACCGTTGCTGGTGTCGCGTACACAAGATCGCGGATTTCAAAGATCATGCGCATGTGGGTCTTGAGTGGGATACGTTCGTTCGAGGCCAG
CGTGAGCATGCGATTATCATCCATGACCGAGTTCATTGATTCGATCCAGTTTGCATCCAAATCACCATCCAAGATGATCCATTTCGGATTGTTGTCTTCG
TCACCATTATCTCGCCGACGAGAGCCCAAGTCACGCATAATACGAGACAGTAATCCATCTTTCCATTCTCGCGTTTTCAGCACGATGTAGCCATAGAGTT
CATTTGTGCTCACGGATTTCGGGTTGAGATCCTGCACTTCCATTGGCGTGCCCATGATCTCTCTCGCTTTCTTGAGCGTCTTCCATGTCTCCGTTTTACC
ACATGATGGCGGTCCCATCACAAACACACAATGTCGGATCGCAAGCAATTCTGAGAGCTGCACGACCTTGAGCATGAAATCAGGGCGAGGCGAATTTCCG
ATTGCTCTGACGCACCTTGCACCATGGATTCCAGCTCCATATCACGTTTTCGAGGCGGATCGTTGCGCACATCGACATTTGGGCTGTCGCGCGGGAAAAG
ATCGCCAAGGAGACCGAAGAAAATCACGGTATCTTCCGCGACGATCTTCGGGATGTTGAAATCACGTAACGCTCGCATGAGAAGATCGATCTCGGGAATA
TCGGGCTCAGCACGTTTAAAGGCACCGGCCACACACAACACACTCTTCACAGCTCGAAGCCCCCAATCGTAATGCAATTGCTTCGAGAGAAGCTGACCGA
GTAACGAATAGAGACCGTAGAACTTGGACGCAAGGATTTTCGCCTGCGTGAACCCTTCAGCCATGAGCATGTTTTCACAAATCAGCACCAGATCTGGCAC
CATGACGGTCATCGGACGGAACAGCGCTTTGAGTCCTTCAGGCAACTCGGAACGACCCAAGTAACCTGGATTCATTGTGATGAATGCTCCCACCGTCGGG
TCCAACATAACTTCATCATTTTCGAGGATGAATTTCTCGTCATCCGCTTTACAAGCATCACACACAGCTTTAAACTGTACCGAACACACCGAGAGCACTT
CAGGCACCAAGCGATTGAACTCATCAAAGCAACCCCACGACCCAGAAGACGCAAGCCCTTTGAAAATGTTGCCCAGACTCTTAAAATCCATTTCCGGTGA
GCAATTGAACACATAGCACACTTTACCGAGCGCATTCGCAAGATCCTTTGTTGTCTCAGTCTTTCCCGTACCTGCCGGTCCGGCTGGCGCACATCCCATT
TGCAAGTTTAGTGCTTGCGTTGCCGTCACGTAAATGCGATCTGTCAGTGGCGTGATCACAAGACGTGGCCCATTGCCGAGGTATTCGTAATCGTAAGGAA
TGCCAGCGTCACAAATGAGGATCTGCGCTCGAGAGTTGTTGATGCCTCGGAAATTCATGTCACGCTTCAGAAAGCTTCCCTGCGTTGGCGAGAAGTAGTG
CTTCAGCTGCGATTGCCATTGGAACGACGTTGCATCGTCGACGCCAGCACGAATCATGCCTGCGACGATATCTCGTCCGTGCGCATCCATCGTGATCAGC
ACCATCACACGCTGACGTTCAGCAGACGAGATGTTACTCTGGGTAAGCTTAATCAAGTCTTCGAGTTGTTTTTCCTGCTTCTTGTTGTACCGCTGGAGTG
ATTCCTTGTCACCTCCTTGCATCTCTCGAAAGCACTTCTCCACTTCCTGCACATAATGCACACCAGCTGCGAGCAAGATGATCTGAGCAGCATCCATGGG
CTTACCACTTGCGTCTTTAAAATTGATCCATTCCACACGCTCCATTTCAGTGTATTTCACAAGCGAGCGTTCGATGTGCTTGAACAACGTGAAACGCATC
GCGCGCATCACTGTTTCCAGGTAAATTTCAGCTTCTCCTTCAAGCACAGGCGGCTCGACGAAGTCCACGATTTCATGGCCCACGCCCGAAACAAACGCTG
TCGCAACGGGACGCCCACCACCCTCGGGCTCCACGAGGTTTAGTGTCTTTGTGGCCAAGTAGATCTTCGAGCAATGCGGCATAATGCGGTCAGGGTGCGA
TCCATTCGAGAGGATATCCAACAGATCAGCTTCCGACATGAAATAGAATCGAGGAAATTGACGACGGCGCCCGTCCAAAAATTCCTTCAGACGATGCTTG
CACAGCTCGAGTTTCTCGACAATAGACTCCAGGCGTTTAATCAGCCCTGGTTCCGTGCATGCCTCGCGAACGTTGAACGTCTTCCATGCTTTTTTTAGAA
TCTTACGCACTTCGACATCAATGTCTTCGAAATCGGCGGTGAGCTCTGGAAGTTGCTTTTTCACTTCTTCCGACTGAATAAACAGTGGCTCGAGGTAGCT
CCATGAACGTTGAATATCACCGAGTAGCACCACGACTTCATTAATAGATGACAACCCCAGTTGAAGGCTTGCGACACGAGGCTCAAACTCCGATTGGTAT
GGCGACGCACTCATCGCCTGGACATCAATCTGATGCGTTTCCAAAAGCTCAAAGTTTTCTTCCGATACTTTAAGAAGAGGAACAACGTCTTCCTCAGGTG
CGCCAGGGTTGTATGCGGTCATCTCCCAGTTCACTTCTGCCCACAGGCCCTCGAGTTCAATCAAGCGGAGCTCCAATTCCTGTTCTTTCTCTGCTTCGTA
GCAAATTTCCGTGATATCGGAGCTGAAATTGTGCAGATTTTTGCTCAGAATAAGCGACAGCTTCTGCTCTGGATCCTCATCGGGTGTCGGGAACTGGCCT
GTGTGGGCCATGATCCGCTGCCAATGCCTTGGCCGCATGTACGTTGACGAGACGCATCGGATCAATGGGTGCGTCTTGTCGAAAGACTGGCATTCCTTCA
GGATCGACGTGTACGCATCACACCATTGAATCTCCTTCGGGATCTTCTTCAACTCTTTCAACATGGACTGAATTTCGATCTGAAGCGAGTTCACATCGAC
GTTCTTAAACAATATCTGATCAGTCGTCACAAAGAATGATTTCGCTCGCTTGATAATCGCCCACACGGTTTTCATCCCTTCAGCATCAGCGCGCATGAGA
TCCATGACGCGTAAGGACTCGTTCATGAGCTGAGGGAAGCCAAAAATCGAGCACAGTTTGGTGTTTTCTTCGCATTTCTTCATCTCCATCTCCCAATCCA
CCAAGTAGCTTTCGATTTTCTCTAATCCTTTCTCCGGATCGAGTTTTGAGGACCAAAAATCGAGTGTTTTCATCGTCTCCATCTTCTTGGTGATTGTTTT
CTCGTAAGCGATGATTTTCTCCTCGGTCTTCTCGCTGAAAATGCGGGTCGGCTTTTGCGTACGTTGCTCAGTCGTTGGTATCTGCTTCTGCACGTCCAAG
AAGAGCTTTTCCATGTTCTCAATCTCAACCAGCTCTTTGTCGACGTGTCCACCAATTTTCTTGATGTTTACAAACATTTGGCGCACTTGGTCAAGTATCA
AATGATTGATTTCTTTCTCCGATTCTAACTTTCGGATAATTTCCTTCACCTTTCGTAATGTCTCGAGGCCGTCAGTCTCATTACTCGGGATATCTTTCCG
CAAATCAATGAGAATGCGGCGAAACTCGCCATTGCGTTTGTTCATGTTCGCCATGAGACGCCGGATGAGATCGGACGAGTCCATGTCTTTTTCGCTATTA
AGCGGCGGCATGCAGCGAGCTTTGTTCTCTTCAGTCGGTTGCTGAAAGAAAATCGTGAACGGAGACCCCCGCACGGGACCTGCAGTGCCGGCAAAGGTTC
CGTTGAAGTCCACGGAGAGCTGATATTTGCCAGCTTTAGGGGCAGCAAACGTGACAACATACGTGCCGTCATTTTTGTCAATGATGCTCGTGATTGGAGG
ATCTTCAGCTTCCGGTGTTGCTGGTTTGCTTGGCTCATCGTACGACTTGAGTACGATCGTAAATTCGTCTCCGCCGCAATCACGCGGGTTGTCGTCTTTG
TCTCTCGACTGGATGATAAACGCTGTCGGGAATTCCGCCAAACAGTTATCGTTCAGCGACGAGATCAAACACGGACCAAATGCCAGTGTCTTTGGCGCCG
CTGTGACCGAGTGGAACTTGAACGATGTCGACACATTTGTGTACATGCCTCCGGAGAGCGATGCGCGGACTTCTGTAAGCAAAGAGCCATATTTCTCGAA
ACTTGGAGCTGTTGCTTGGATAACCGTGGAGTTCAATACTGTCCCCACGACGTCTACGAAGCCTTTTGCGACCGCAAAACGCAGATTCGCCGATTGCCCT
GCGAAGTTGTACCCATAGACTTTGATCTTCGCATTCCCCGTGATCGGTCCACTTGTTGGCTCGATGGACGAGATCGCGTACGGAGGGCCGACGATTTCGC
TCGCATTAAGCACATGCAGATCGTTAAACCACCGGTTTGCCCAGCCGCCGAAGAAAGTCAAATGATTTGTGTTCTTGTCGAACACCATCGTCGTATCTGC
TCGGGGAGTTGGAAAATCTCCCTTCACTGGAGGGCTCACCCACTCCATGATGCCTGTGTCAAGCACCATAACACTGTTCAAATACGCGCCTTGTGCTGTA
CCCGACTCCGCTAAATCTCCGCTGTTGCCGCCAAACATAAATATTTTCCAGTTTGGCACTGCTGGCACTCCTACACAGGTATGGTTCCAAGTCGGCGATG
GCAGACGAACGTTTAATGTGCTCCAGGTTCGTGTGGGAAGGTTGAAGACAAAGATGTCCTGAAATTGCTTAAAGCTGTTCCAGCCGCCGATCACGAAAAG
CTGATCCTTGATCAAACACGTTTGATGGCCGGATCGCGGCTCAGGCTTTTCGCCCTCTGTTTGGATCTCTTCCCAACGGAATGTTGTCAGGTCAAGTGCA
TGCAGGTCGTTGAAATCGGTTCTTCCGTAGCCATTTCCACCATACCCGCCAAAGATGTACATCTTGTCTTCCACGAGAGTCGCACTGTGGGCTCCACGGC
ATTGCGGGAGCCCCTCCCAAAGTCCCTGAGGATGCTTCTGCTCCCACACGCGCAGCTCCGTATTGAAGATCCATAGGTCATTCATTCGCTTTTCCGCGGA
AAAGCCACCAAAGATGATGATCTTTTTGCCGTGAAGCACTGCAGAATGTCGCCACCGCGGAGGAGGCAGGTCTTCTGGTCCATTCGCGCTTGGAATCACT
TTAGACCACGTGTACCCTGTTCACATGACAGTAACAAGCATCAAAGAATGAAGTAAACCATTTTTGAGTTGTGATTATCCACTTACCATTGTTGATCTCG
ACTTTGAAAAGATCATTCGTTGGACCAGGCGGGGACTTGTGATCGCAGCCTCCAAACATGTAAATCGAGGTCTCGTTATCTGTGCTCTTGAGCGTGAACG
AATGGCCCGATCGCTTCACGGGGATCTCTCCATTTTGTTTGGGCACGATCCAGACAAGCTCCAGCTCGCATCCGAATCCAATAGGCTACTCAAAATGCCC
AGTTAAAGCATATCATGAGTGAAGCGAGTATCGCTCATGCGTGGAGGAAACATAACAACAACATGTATTTCGTACCATGATGCCGAAGCAACCGAACTAA
CGCAAGTAGAGCACACTCGCTGCACCCTCACTGTCTATTAAGGCCACCTGCGCTTGCGTATGTCGCCGACTTCCACGCGCTTGGCGTTGCCGCTGCGCGG
ATGATCTAGGCTTCGCAACCTTTCCTGCGAGCTCTGCTCAGTCGACACGAATGGATGTGAACAGGCACGAGATGCAGCAGCAATACTTACCGATAGACAG
AGCATCAAACGGAGGAAGACGCGAAAGGTTGCGTAAAGCGACGTCAAGAGTCGCGACCAGTCAAGGAACGTAACGGAGGAACTACACACACTCGTAAAAA
GTTAACCCATCAGCTTCAAATGCATGTGGAGGTGACGCACAAATGCACATGTAGCATGCAACTCTCATCATCACAATAAGGGAAGCCAAGAATTGTACGA
TTGTGGGCTAGCGTCTGGCGTGTACAATCGTTTACACCTTTGAAAAAGTCCCCATGCTGCCGGGCCAACCAGTTGGGTGCTGGCGCTCTCTCATTGACAG
CTGCATGTACACAACTTAGTTGTTAAACTTGAAGAAAATGATATCACCATCTTGCACCTACAATCGATGGGACAAAACGTTAAATGACGAGAACAAACAA
TGATGAGATCGTTTGTGTCAGTGGAAAGAAACAATTAAAAGTGATGATCGTACCTCGTAGTTCTTTCCCTGGAGCTTCAATTTACCAGCCTTCTTGACTG
CTTCTTCGCTTCCCACTGTAATAGTACATCATCATCCAATTTTACATATAGATTAATATACGTGACGATGCTTAACCAAAGCAATTTGCCAAGCATACTC
ACATTCTTTAACGTCTGCAAAGGCTTGCACTTCGGCCTTGATGAAGCCCTTTTCCATGTCGGAATGGATAACACCAGCAGCCTGTGGTGCTAATCTGCCC
TTGCGGATCGTCCAACTGCGAACTTCCTTTCCGCACGTGAAGAAGTGGATCAAGCCAAGCGCTTGGTAGCCCGTCTTCAGCACACGGTTCAGGATCGACT
TGTGCGTTGGGTTCTCCTTTTGGTACGCTTCCAGTTCGCCAGACTCTTCCAAGTCCAGCATTTCCAATTCGAACTCGCAACTGAGAGGAATCACTGGCTC
TTCGCCACCACGAGCCTTCACGAACTCAGCGATCTTTGGCAAGTACTTGTTGCTCTTACGAAGGTAGTCCTTCTTGCTCACATTAATGAGAAAGACCACG
GGCTTGGCAGTCAACAACTGCAATGGGTTCAAGATGTCAACTTCAAACGCGCTCCATTGGCCGAACGACACATCCTTGCCCGATTCCAGCCACTCCTTCA
CACGCACAAGAGCTTCATATTCGAGCTTCTTTTCCTTGCCGCCTACACCACGTTCGACGTTCTTACGCATGCCGTCAACAAGCTTCGTGACACGGTCAAT
ATCCTTCAGACGGAGTTCCTGCTGGATGATCTCGATATCACGCACGGGGTCGACGTTGCCTTCGACGTGGGTCACATCCGGAGAATCAAACGCGCGCACC
ATGTGGTAAATCGCATCGACGGCCTGGATGTGCGACAGGAAGGCATTTCCAAGACCGGCACCTTCAGCAGCACCCTTGACTAGACCAGCGATATCGGTAA
TGGCGATCACTGGAGGCACACTTTACAAAGCAAATAAACAGCGAGCGATGGCGCGCACGGCAATCAAATCAGTATACTCGCACTGTGTGAGCGACATCTC
AACTGCAGTGCATGCAAAGCAAAACGCAAAGTTATGGAGAAACAACGTACACACTGATGGCGTTGTACTGCTTGACGAGCCAGTTGAAACGCTGGTCAGG
CAATGGCACGACGGCCTCATTCGGTTCAATCGTGCAGAACGGAAAGTTTTCCGCAGGGATATTGAGCTTGGACAAGCAGTTGAAGAATGTACTCTTGCCG
ACGTTTGGGACACCGACAATGCCGATCTTCACGTTGTTGCCTGGTCGGCCGAGGTACACGCGCTTTGG