Description :
From Genome Similarity Track
Location :
Scaffold_74:11320- 14694
Transcript NameFunction/comments
g4497.t1hypothetical protein

Sequence
3374 bases(100 bases per row)
GCAGTGACCGAGCTGCCATTCCCTGCTTCGAAAAAGGGGATGCAGTCTTTCCTCGGTGCGCTGAATTATTACAGTCGATTCATCCAGGACTTCGCAGTGT
ATGGAGCAGCTTTGTACCAGTTGAAGGACGAAGACTTCACGCCTAGTGGTAGCCTCTCGGCGGCCAAACGAAGCTTCGCCGCGCTCCAACAGAAGGTTGC
AGAGGCACCGATCCTCCGGCACTTTGACCGAGACAAGGAGGCGCATGTCACGTTATTCGCGAATGAGTGGGCATTGAGCTCCACTTTGATGCAATACCAT
GATGACAAGTTACACTCGGTTCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACTACCATCGTGCCGAAAAGGAGGTCTTAGCGCTACTGCTGG
TGTTGAAAGTGTGCTACTCCCAGTTGGTGGGTCGGACCATCCACGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCTAAGACACTGTTCGG
TCGAGCGACCCACTTTGCGGTTATGTTGTCCCCATGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGCACGTTTGCTCAGCTTCTCCAAGCTGGC
CTCACAAGCTTCGTGGAGTTGGAAGACTCGTTGGCCCCGGTTACACCGCCGACGAAAGGGTCACCTACTGCTCGTATGGACCCCCACTTGCTTTATGCCT
GCCTACCGAGGTCCTATACCGGATTTGTGATGTCGTTCGATGGTTCGGCCAAGACCGAAAAGAACGGTGGATACGGCAGTTGCTCGTGGATTTTGTGGAA
ATTACCAGAATGGACTGTAGTGACGGCTGCGAGTGCTTATCTCGAGACCACCACGGTAAACCTCGCTGAGTATGCTAGAATGAACAACGGCGTCTCAGCT
GCGCTCGAACATGGAGCCGAGGATTTAGTCATCGTGGGAGACTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGA
TGGTACAACTGAATCGTCACCGAGAGCTCACGACCAAGCTGCGGTCGGTGAAGTACTTGCACGTGGTCCGAGAATTCAACGCTGCAGCAGATTCGTTGGC
AAGCGAGGCTCTCAGCAGCAAAGAATCCAGCGTAGCTTCGACCGAGGCTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAGAGGTCATCTATGAA
CCCTCAGTACAGACCACGGCCGAAGAGAAACCGACAGTCAGCTTCGCCCGAGCCCAAGTAGCCCATGGGATCTCCCGCGACAGATCTTTTTTCGACTTTG
TGCGGGACGAACCCGACTACCTAACTGCAACAACCAGACACCAAGCAAAAGCGAGGAAGAAACGAGTCCAGTTTGCAGATGAAACGTCGGTGATAGAGCC
GAATGGTACAGCTGAGCGAGACGAAGCGAATGGTGTGACCACCGAAGCTCAGAGTGAGCTGAGAGCCGAGCAACGAGGCAGACCCTGGCGCTCCAAACGC
AGAAGACGTTGACCCTGTGGTTATACAGGAAGAGCGCCGGAGACGAATCTCCGCCGCCCAGGATGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTCCTC
CGAGGCAAGGAAACAGACCTCAGCTACAGAGCAGCCAGAGACGCTTGGAAGATGGCCGACAAGTTCGTGCTTAGCGAGGATGGTGTACTGTATTTTCTTG
GAACGAACCGTCGGTGGGGCAACGAACGCCGAGAGGAGACAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTACTACGGAGTTGCCACGA
CTCGTTGGAAGGTGGCCACCAAGGTATCGGTCGAACGTACCACCGAGTCAAATCAGACTATTTTTGGATTGGACTATATGCAGACGCCGAACGACACGTC
AAGTCCTGCCCCGACTGTAGTTCGAGCAAAAGTCGACCACAGTTCCGAGGCTATTCGCCAGGAAATGTCTTAGCAGAGCGACCGTTCCAGATGGTGTCGA
TGGATTTCGTCATACCGTTACCGAAGTCTCGTCGGGGCAACTCAGCCCTACTACTGTTCCAGTGCGCGTTCACAGGATTCGTCATGAGTAAAGCTATGTC
AGACACTACCGCTCTGAGGGTCGCACAGGCTTTCGAGGAGTGCGTGTACCGAAGATTCGGAGCACCAACTCTGATCCGACATGACCGAGACCCTCGCTTC
ATGACCGAGACCCTCGCTTCATGAGCGAGGTGTTCCAGGCCTTTGCAGAAATGATGCAGTCTCGGTCAAGAGCGACCCTCAGCTATCGGCCGCAGGCGAA
CGGACAGCAAGAGAGGTCGGTGAAGACGGTCATGCAATCGGTGCGGGTGTACGCAGAAGACCCGCTGCAGCAAGACTGGGACGAGATCGCGGAGCGATTG
ATCTTTGCTATCAACAACTCTCAAGATGGCACCCGGAAGGACACTCCGTTTTACCTAGTTCATGGGTGGGACGCACAATCCACGCTGCGAGTGATGTCGT
CGTCACTCAAACGAGGATTCGGAGGCCAGACTGACGCATTGGCATGGCGCCGAGAAGTGAACCGGCAACAGGAAATCTCGTGGAAAATGGCAATGGAGTA
CCAAAGTGTCGAGAAAGCTCGGAGGGCGAGAGAACACAATGAGTCGCTGGAGCGACGTGAGAGAGCTGCAGTACCGAATATCGATGAAAACGAGACTTCT
GACGAGTCACAGGTGGAGACGGGGGCAACGTCTGACCCCACTGTCGAAGGACCGAGGTCTCTGTTCCAACCCGGGAGCAGAGTTTGGTTGTATATGGAAC
GAGTCAAGCCAGGGTTGACCAAGAAACTGGCCCACCGATGGCATGGGCCATTCAGGATCAAGAAAAAGATAGAAGAGTTTGCGTACGAGTTGGAATTGCC
AGACCGAAGTGGGTATAGGTTCTACCCGGTGGTGCACGTGTCCCGACTCAAGGCCGTCAACGAATTCGGAGACCGACCGAAGAGTCGGCTAGCACCTGAA
GTGACCGAGGATACGAGATTGGACTTCGACGAGGAGTTGTTGCCCGAAGATAGCTGGGAGCCGGATCAGCTCGCTGGCGAATATGAGGTAGAAACCATCC
TCGATGACCGATCCCCGCTGTCGACGAGCACTAGCCGTGCTGTCCGAGAGTTCAAAGTGAAGTGGATTGGGTATGATGAGCCCACGTGGGAGCCTGCCTC
AAATTTATCATGCGGGGGGCTACTTTACGATTATCTGCGGACTCGGCGCAGCGAACGACGATTGCAGATGGTTCAAGTTGCTGACGAGAACTAATCTGGA
GAGCTACCGAGAGTTGAACTGTCTACGGGGGTGATACAGCCCGTAGCAACAGATGAAATTTGCTACTGTATCAA