Description :
From Genome Similarity Track
Location :
Scaffold_253:11319- 12802
Sequence
1483 bases(100 bases per row)
TCTCGAGGCTTTACCATCAGTGGTGGCGCCTCTCGCCTTTACCGCCTTTTCAATAGGCGCCTAAACTAGCTTAGGCGCTGGGTTTAGGCGATTCGGCTGC
CGATTCGCCCTTTGGGTTTAGGCGCGCGATTGAGGACATTGAGATTATGTATACTATCATCAATTGTAGTGACTGTAAATCATACCTTTCACAAAAGATA
TAATCCAATTGCAAGACGTGCGCAAGAAGGCGTTGTGTTGCCCCCCCCCCCCCCCCCCCCCCCCCCCTCGTGAGTCGTAAGTACCAGCCACTCAATCGGT
CTTTATGACAATTGTGAGGTCTCTAAGTGGATGTCTTTTGAGTGCTTCCAGCCTAGTGTTTTGCCTCCCCAACCCTGTGAATATGGTCCGCCCGCATATT
CCCGAAAGAGAACATTTCACGTTAATGCGTGATATTCCCAGAAGCAAAGGCAACTACCCGTACTATACGTGTAAGCATTGCACGCTCGCACACAACCTGA
ACCCCGAGTTAGACCCTCCTGAACTTATCTTAGGGCGTTCCTGCAACTACGTTAGCCATCTTAAAAAGTGCGAAGCGTATCGAGTTTCAGCGGGACCGAC
TCAAGAACAGTCTAGTGGGGATTCCAGTTCAGGATCAGGATGCCACAAAAAGCGACCAGTAAATAAACGGCTAGTTTTCACAAATGCGTCGCCAAAGCGA
AGCACGGGAAGGCGAACTCCGCAGAAGACAAAACGCAACCGCCGCTTTTCGAAGATCCAAAAACAAGAGCTTGAGCGCCTTTTAGTCGAGTTTCAGGCAG
GAAATCTGCTTCCGGATCTCTTCATCGAACGTACATGTACAAGAGCTTTGTTCGAGTACTTGTGTCCTGGAATAGCGACATATCTACCGTCAAGACGTGT
CCTTGGAGGTCGAATATTGAATTCGCAAGCTGACCATTGCCGTGAAGTCCAAATTCAAAATCTGAGACAGGAGCAGACGACTACGGGGGGGCTACGCAAA
CTTCCTATCAGATGTGTGGCAAATTATATCTCGCGAGCATGTGCTCGGATGTCAACTACAGCTATTTGGGAAGAATCTAACCTACTCGTTGCCGCAAGCT
GGGAGCCGACACGATGGTACTGCGATTGCTGAAGAGATGGACACAATACTGAACCAGATGACGAACGAAGACTGGAACGTGGGGGCTGTAGTCACAGATA
ACGCCGGCCAATGCGGAAGGGCTCGGCGAATCTTGGCGTTGCGGTGGCCGAAAATGGTGTTTCTGTTTTGCTTTGCACACTGCGTAAACAACATTGTGAA
GGCAGTCCTAAAGTCTGCTTTTGCTGATGTTGCTACAGCCACAACCACTGCAGTGAAGTGTCTTAACGCTTCTTCCTCTAAATGGCTCGTACGAGCAAGG
GCGATGATGACGGAATGCTACGCGAGACCACTAGCATTGTTCACGTTGTGTGAAACTAGGTGGAACAGCATGCAGAGCTGTTT