Description :
From Genome Similarity Track
Location :
Scaffold_160:11318- 12766
Transcript NameFunction/comments
Albla_Nc14087400ubiquitin putative
Albla_Nc14087410ubiquitin carboxylterminal hydrolase putative

Sequence
1448 bases(100 bases per row)
AGCAAACGTTCAACTTTGAAGCTGAGAATTCAGTATATCCGATACTGCATATACTTATATCCCGTCAACATCGCTAACATTAATGCTGAGTAGATTTTTC
ATGTTAAAGAAGCTCTACAAGAGAAAGAAGGCATTCAGGTCAACCAGATCAGGTAACAATCCCTCATTCCTTGTAATCTTTGTGCTTATTTTCGAGTGTA
GATTGATTTATAGCGGAAGGCAGCTGTACGTGGGAGCAAACACATCATAACAGTCTTCTAACAGTTTTAATTGTTATGACAGATCTGATAACAAGACACT
TCAAGATTACAATGTCCTTGCGGGTGGTACCATTCATATGGTACTCCAGCTACGAGGAGGACAGTCATTGTCACAAATATAACCCGAGTCCGAATCAAAA
TTACAATTATGATCGTATTCTTGGCCGGCCTGACATCTTACTGAATATTCGTATTCGGTTCAAGTTGCTGCTGGATCAACGGTTCCAATTGATTTTTTTC
AGCTAGGATCTTGAGCAATTGAACCACAAATGGAATATAATTATGTTTTCGACGCGCGTTCTCCAATACCCATTGCTTCTGCTTGTATCCTTCCTGACAT
ATCATGTCTTGATACTGCGCAATTGCACTCAAACTCTCTGGTGAGCGAGTTTGTACTTGTAATTTCTCAACTTCATGCTGATACACATCGGAGCGGTTAC
GAATAAGTGCTAGTAGATTGAATCGGATCTCTGAGGTTGCATACTTTTCAATACGAGCTTGTATCTTTGGGCATGCAATATCCAGCCAGGCCGTATTGTT
CGAATTAGATGTTGCGGGTATGTTACCAATGGAAATGGGCTCTTCCTGTAAGCCGTCCAGCTCGTACACTTTCCCATTTACAGGGACATACGCGATGAAA
TGATATACTTCATCATCATCGTTTTCATGTTTTCTCTCCTCCATCACGAAAGGGTCGGGTCTCGCAAAGGAATTGTGAGCTTGTCGAATGAGCTCACTAT
TAGAGATAGCCAATCCTTTCAAATCCGGTGGAAAATCTCTTGTGAATGACTTAAATTCGCGAAGTGTATCTCCAATATCCAATTCCGCTGCATTCAGCAC
AATGGACAAGATCGCTTGGGTGGCACACGCATTACTGATAACCTGTTTGGCAAAGAAGAGATTCTCTGGAGGTGGTGTGCTTCCTTTTGGCGTGCAGGTT
GTCTCAGGTGGTACCGTATGTTGCGATTTCTCCCATTTGAACAGGAAAATCAGACCATATACCGGACCCATCGATTGGAATTGCTCTCGATCTAGCGAGT
ACAGCTCTTCCATTTGCGCTCCTTTCACCCCAATATCCTTGAGCAGCGCGGTAAATACACCTATACCAAATCGTCTCATTCACAGCAGTAGCATCACGTC
TGTAGAAAGCGTACCTGGATCCGATTCGATCGTGCACCAAGACATATT