Description :
From Genome Similarity Track
Location :
Scaffold_530:11314- 16143
Transcript NameFunction/comments
g15144.t1XP_002908098.1 helitron helicase-like protein [Phytophthora infestans T30-4
g15145.t1ETK76835.1 hypothetical protein L915_16834 [Phytophthora parasitica
g15146.t1hypothetical protein

Sequence
4829 bases(100 bases per row)
CATCCTCACCACCACGAACGCGATAGTCCATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGACCAGCTCGAGAATATGTGTCCACGGACTCAGTG
GAGGATGACGAGGACGGGAACTTATTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGC
CGATCATCATGATGCGGAACTTAAATCCCGACCTGGGGTTGTGCAACGGAACACGCCTGCGAATCGTCGAACTCAAAGATCATGTCATCCACGCCACCAT
CATGGCCGGCGACAGGCAAGGCCAGCATGTGTTGATCCCGCGCATCGTGTTCATCAGCGATGGCGACATCCGCGATTTCCCATTTCGACTGAGACGCAGG
CAGTTTCCTATCCAGACTGCCTTTGCCATGACGATCAACAAGGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCC
ACGGTCAGCTGTATGTGGCCATGTCAAGGGTTACGTCGAGGTCGAGATTCAAGGCGTTGGTCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGTACAC
GGCGAACATAGTGTACCGACAGCTGTTCGAGAGGGCGTAGGCAGCGACTTCGTGTGAATGCATATTTTACGAAAGGAATACATTTGTCACTTTGCATAGC
GGTAATTGTTGAGAGTCACCATTCCCCCTCGAGCGCAGCGAGCACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACGAAAC
AGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTG
CGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAACAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAG
GGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCA
GTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCATGTGAGACGAGCGCAGCGAGTACGCCTGT
GGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAG
GGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACA
GTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTTTGATACAAGTCTACTGTAAAATATACTGAGATAAAACATAACCCT
GTCATAGTAAACATAGTAGTGAAACGAGCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACCCACCGCCCGCAACGCGGGCGGCGCTCGGCTAG
TTTGTACAAGTTATCTGCGCTGTCTGTCACTGTCCGTTACTCACTGAGGAGGAATGTCCTCCTCGGAGAGCTCATTCCTCGCAAACCTCCGCAACTTCCG
CATGGCACGGGCAAAATACTTGGTGTCTTCGTGATACTGTCGCCGCGCTCGGGCTCCCATGGCTGCTCGTTGCTCAGTGGTCGAGGACTTGATGAACGCT
TTGATAGTGTTGCACAGTCCGTGGGAATTGTACCTGACCAGAAGTCCGTTCGGGTCTTTCAGTCCATGCTCGCCAGGGTACTTGCCCCCGAGGAGCATCT
TCGGGTCATGCTGGTATCGAGCTGGAATGAGAACGCCCATTTCGTTCGAGAGAATCAGCTCGTTCATTGGGTGGGCATCGGTCGTGACCACAACTCCTCC
TGACGCACGCGCCTGGTTAATGTAGTGGCCGTAGCCTTCGCTCCGACTCGGACACATGAAAAACGCCGATTCCGCCGTCAGCCTGCTGAAGTCTTGCGGC
TTCAACATCCCATGCTCGATGTGGACAGGGCTGCGACTGCGATCAAGTTTGCGCTTGTAGGACGGCGGGAAGAAGAAGTTAAACGAGCTGTCATCGATGT
AAACGTCCAATTGAGGCAGCCCCGCCGCCATGACCCAGCAATCCACCAGCTCTCTCGTGCCTTTCCAAACGCTCGTTCCTGCCGTGTGGATAAACTTGAC
GCTGGAGAAATCTTTTGGAGCGACAGATTCATTGCCCAGTCGGTGTCGTGCGAACTCGGCTTGGTCCGAAGACGTGTGCTTGGTGTAGAACACTTTGGCG
TCGCGCGGGTTGCCATTCTCGGTGTACCAGCGCGTGACTCGGTCGTAGCACACGTGCGTCTTGCACAGCACGGCATCGACGCCCCAGTAGTGTTCAGATG
ACAGCTCAGTCATCTCAATGTTGGGCATCAAGTACAGCGGCTTGTCCTTGGGCCAGCGTGGGGACTCTGGCACGCCGTCCCAGTAGTGATTGAAAAAGAT
CACGGGCGTCTCAGGACACAAGTCGTAGTAGTCCACTAGTCGTCCGAGCTCCGAGTCGAACCACTTGGTCTCCAGTACCCACATCGGCAGCAGTCTCGAC
TCGAGATCTAAGTCACAGCCACAAGGTCAAAATCCACTCACCACCCTTCCCAACAGCAAAACAACTCACACTTGGCGTACGCAACCGCGTCTTCGCAGTA
TCCGTTGCCACGCAACCCCAAAGGCAGGAAAATATCCACATCCGGACACTGCCGCAGCTTGTCCAGCAAGTTGGTGTCGTTCCGGCTCAGTAGTTCGTAG
TCGTTGTCGGCCGTCGCGTTCTCCCGTTGGTGAGCTCCTACCGGCGAGCCAAACTGCCACGAAACGACGGCGTCGACGTCGGTCACGCACGCTTCGTGCA
GCAGACTCAGGTGCAGTCGGTCGACTATTGGCACCTCCGCGTCGTCCGATTCCGTCCACAATGGCGCTGCATCGTCATCGCTCTGCTGCCACGAGACACC
GAGATTCACGACACTGCGTAGTCGCGAGCCTCCGACGTCGCTGAGCCCAAGCAGTGACAAGGTCTCCAATACCAACGTCAACGCACACAACGCCACAAGC
GCCACGAGGAACCCACGTAGCCAGAGCGGACCCTGTGCGTCCTTCATTGCAGATCGAAGACTGAACCTCATCCCTCATCCTGCTGCTCAAAATCCGTTTG
CGTGTGACTTGTGACGGGCCCTGTCCGTGGGTGCTGCCCCACCCCTGCTCTTGAAGGAGCTGGTCGTACGTCAGTCTCCCATTGCACTCCTTCGTCCAGC
ATGAGCATGAGCAGGACCAAGTCACCCAATTGGCTGCACCGCCCTCTCGTGGCGCTGCTGGCGCTGGGGCTGCTCACGCTCGTGGTGCAGATCTCGTCGC
TGCTCGGACGCTCGGGCGACCAGTTGACCGGCAGCTCGCGGCTGCGGCGCGCCATTAAGAACATCGCGATCCCGTGGCGACATCGTAGCAGCAATCGCAG
CCACCACTTAGAGACGGTTGCAGAGGCTGTCGACGAGGTATCGGATGATGACCTGCTGCATCTGAGCCTGCTGCACGAACGCTGCGTGGCGGACACGGGT
GCGGTGCTGTCGTGGCAGTTCGGCAGCCCCGGGCACCAATCGCCCAATGCCACGGCGAGCAACCCGGAGGTTCTCATGCACCGGAACGACTCGGACTTGC
TGCAGAAGCTCCGCCAGTGTCCGGACGTGGACGTTTTCCTGCCGCACCATTTGCACGGCAATGGGTACTGTGAAGACGCAGTCGCCTACGCCAAGTGTGA
GTCTTGTTGTTGTTTTGGATGCGTGGGGGGAGGCTGACGGTGACCTGGTTGTGCAGATTTAAACTCGAGGTTGCTGCCGCTTTGGGCGCTGCAGGTCAAG
ATGTTCGACTCGGAGCTCGGACGAGACGTCGACTACTTCGACTTGTGCCCCAAGACGCCCATGATCTTCTTCAATCACTACTGGGACGACGTACCTTCGA
TGCCGCGCTGGCCGAAGGACAAAGCGATCTACCTGATGCCCAACATCGAGATGATCGAGCTCACCCCCGAGTTCTACTGGAAAGTGGACGCGGTACTGTG
CAAGACGCAAGTGTGTTACGACCGAGTGACGCGTTGGTACGACCAAGAAGGCAACCCTCGCAACGCAGAGGTGTTTTACACCAAGCATACGTCTTCGGAC
CAGGCGCAGTTTGCGCGCAAGCGTCTTGGTGAAGACGCGATCACCGCCAAGGATTTTTCCGACGTGAAGTTCCTGCACACCCCTGGAACAAGCATTTGGA
AGGGCACGAGAGCAGTGCTGGAGTGCTGGACGTCGACGGCAGGATTGCCTCCACTGGACGTGTACATTGACGAGAGTGCGTACGCCTACATGATGCCCAC
CCAGTTCCAGGTCAAGTTGAAATTCAGTCGCAGTCCTGTGAACGTCCATTTGGGCATGATCGAGCGCTCGGAGTTCACCAAGCTGACAGCAGAGGCTGCA
TTTTTCATGTGCCCAAGCCGTAGTGAGGGCTACGGCCACTACATCAACCAGGCGCGGGCCTCTGGAGCCGTCATTGTCACAACGGATGCAGCCCCGATGA
ACGAGCTGATCCCTTCGAGGGATATGGGTGTACTGGTTCCAGCAAGATTTCAGAAGGACGACAGGATGTTGCTCGGCGGCAAGTATAAGGGAGATCACGG
ATTGCGAGGCGTCAGCGGTCTGGTTGCTG