Description :
From Genome Similarity Track
Location :
Scaffold_42:113130- 117759
Transcript NameFunction/comments
g17343.t1hypothetical protein

Sequence
4629 bases(100 bases per row)
CTTCTCCATCAGCACCAGCAGTCGTCGTGGGGACGTTTACCTGGACACTCTCGCCGCTACCCGAAAACAGCGGCAATCACGATTCGGTGCTCGCTGGAAG
TTTTTCCTTCGGACGATCTTGCGTGGACTGGTCGAGGGTCGGTGTGATTCGGACATTCTGCTTGATCCTTTCTTCATGCACCGACCTCGGCCGGGTGAGG
AGAAGATGTGGTATCCAGGGCAGCATGGCAACTCGCAGGCGACGAATCTGATCACCGCAGTCCAAGAGGCGGACTTGGCTGAGCCCTGGCGGGTCCAATA
CCGCCACGACATCCGATCGCATCCCGCGCAACGTATTGCGCGTCTTCGTGGTAAATTCGTCATCCCAGCATCCCGTTAAACGTACACCTGAGTGTCAGTC
TGCATGTAATTCCATTTTCACCTCTTTTTCTCCAGTTGTCTTCCTTGATCGGGTCGATCGAACCTCGTAATCGGTTCTCTCCCCCTTCACGCCACTAGTT
TTTTGTACATATACCTCCTCCTTCTTTCTGAGTGCAGCCACCCTGCACCCAATTCACTCTCAACTCGCAGCGATCGCCATGAGTTGTCCTCCTTCTTCCT
AAGTGCAGCCACCCTGCACCCATTTCACTCCCAACTCGCAGCGATCGCTACGAGTTGTCCTCCTCTGTCTCGTGCGATTGCATCACTCCGAAGCGATTCC
GTCTAGTACGCTCGCGCTCGAACTCGTGCAGCAACGCCCTGCAGTTGAGGTCAGCCTCATCGACCCAAGACGGTTCGGTGTATCCCTTCCAGAAGACCTG
GAATTCCCGATGGACGCGTCCATATCTGGTCTTACGACCCGATCGGACATCTGCGATCCGCTCCACTTCAAACTCGTCATCGCTCCGATCACCTTCCCAG
CTGTCCTCCGGCAACAACGCCTCATCAAAATCAAATCGACCATTCTCGTCCGTCGCTAGCGTCACGTCAGGGCGATCAGAGAAAACCTTCACGGCCTTGA
GCTTCGAGACGTGTACAATTGGAAAAAGACGATACTCGGTGCCGGCCACCTCTAGCCGGGCCGCGTAGGGGCCAATCATCTCGCGCACCCGGAACGGTCC
GTGCCACATGTGCGCCAGCTTTCGGGTATAGCCCTCCTTAACTCGATCCAAATATAGCCACACTTGTGACCCGGCCTCAATCTGGTGCGGCCTTATCCCG
TCGTTGTGGCGATCGGCTCTCGTTTGGATCGCCTCCTTCAGGCGCGCGTTGACCTCCTCGCGAGCTCGCTGGTACTGTTGCTGGATACGATATCTCCATC
TGCGCGGCTCGCGATCGCGACGTCGCGTGCTGCCTAACGGTAGCGACGCTTCCAATGTCGATCGTGGGTCCCAGCCATGGACAAGGTAAAACGGCGTCTC
TCCTCGTACTCGATCGTGAGCCGTGTTGATCGCGAAAGTCAGGCGTTCCGCGTATTCGTCCCAGTCTTGTTGATTCACATCGGCGACATACATCTTCAAA
GCGCGAGTAAGCGTTTGCACCATCCGCTCAGCGGTACCGTTTGCCTGTGGTCGATAGGCCATGGTGGCTCGTTGTCGTTGTCCCACTATACGGCTGAATG
CGCGGAAGAAATCAGACATAAAACCGGGCTCCCGATCATGTCGGATCGCTTCGCTGGCTCCGAAGCGGCGGAAAACGCATTCCTCGTAGTTCTCCGCGAT
GGTCTGTGCTGTCCGAGACGCGCCGGCCTTAGCGATCACGTACCCTGAGAACAGATCGACCCACACGAGGAGCTCCGTGTTGCCCTTGAACGATTTTGGC
AGCGATGGGATATGGTCCATCGCGATGATTTGGAAGGGGTAGGTGGCCCGTACATTCCCAGGTGATTCTCCTTGAACCACGGGGCGTCCCTTCCCTGTCT
CGCAATCCACACATTCACCCACAAACTGCTGGACACTCTTGAACAGCCCCCGCCAGTGGAAGTGTGCTTTGATCCGTTGGTACGTCCTCCCGATTCCCTG
GTGCCCTCCTTCAAGGCTGGCGTGATATTGGTGAAGGAAATCTTGGTGTAACGTTGCAGGTACCACCAGACGCACGATCGAATCTCGGTCCTCGTCTAAT
CGGGCGGTGTTCACACAGTAGAACAGCAGGCCGTCTTCCCCCACTTCGTAATCTCCAGCGATCTTGGCGCACGCTTTTGCATCCCTGGTAGTCAAGGCTG
CTACGTCGCCCCGTAGGTACGACTTCAGGTCCACGATCCACTTCTCTTCATCCTGAGCTTGTACTAACCTCTCACTCCTCATGCGTTGGACGATCTCTTC
TTGCAAAGCTGCCGGCACTTGACGGTACCGTCGGGCTGAGCGGGTCACTGCTGACACTTGAACGACGGGGTCGTCATTACTCGGGTGGAGCAACTCGCCC
AGGCGGTTGATCGTGACGAGATCGCCAATTTCGCCCTCATCAGTTACGATCACGCCTGCTTCTCGTTGCAGTGCCGCACTTGCGAACCGATCGGCGCTCT
GATTCCAATCGCGCTTCACATGGAGGAATTCGTGCTCCGGTCAGGCTTTCACTTGATCCATCGCTTTCTGACGTAGTATCTGGACACCTGGTGCCTTGCA
ATCGATTTCACCACGCATCTGTCGGATGATCAGATTGGAATCTCCACAGATCACAATTCGCCCCCTGTCCTGATCGGACAGTAGCTTGAAGCCTAGCAGA
AGTCCGCGATATTCGGCTTCGTTGACAGTCAGATCGTCGGCGAATTCGGATGCGGCAGATATGATCGACCACTCCGGGAGCTTCTAAACAATTGCACTAT
ACGCTCCGGCGCTCCGCTTGACGCGTGCTGACCCATCAAAACTGACGACGAGCAACTCTCCATCCAGCTCTACCGTCGGCGGGGCCATCGCGATCGTTCG
TTTGGGCTCTTTCACCGGTGCAATCGCGATCAAGGCCTCGTCCACTTCCGCTCGGGGTGTAATGCTGGCGGTGATCGCGCCCAGGATTTCGTCCTCTCCT
TTCAAGAACTTCCGGATTTCCAAGGTCCACTCGGACAGCAGAGCTGCCCATCGTCCCAATCGTCCCTGGAAGCCCGACGCATTCAGCAACCAGGCGAGCG
TCGAATACCTCGACAGCACCTTGATCGATCGGTTGGTCAGGAGTGTGTAACACACGTCCAAGATCCGGAGGAGCGCCAAAACTTCCTTGTCCACTATGCC
GTAATTCAATTCGTTCGACTTCAGCGTACGACTGGTGAAGATCACAGGCCAATACATGCCATCATGTTCCTGAACCAACGCAGCTGAAATAGCCCGCTTG
TTGGCGTAGACCACGATCACAGGCTGGCGATCGGAATCGAAGTGTCGCAAAATCGGGGTGGTCGCAATCTTGGCCTTCAGTAGATCGAACGCCGTCCTCG
CTCTAGTCCACCGATCGTCGGACTCCGTTGCTTGGTCCCCGTGCTTCTCATGGTGCATCTCGTAGAAGTCCACTTCTCGCAGTTCGTATAAGATCGCGGC
GTAAACGGCGAAGTCTTCAATGAAGCGACTGTAATAATTCAGGCTTCCTAAGAAGGACTGCATCGATCGCAACGTCTTCGGAAACGGCAGCTTCTCCAGC
GATTCCAGATCTTTCGGATTGGCTTCCAAGCCTTCGGCCGATACCCGATGACCCAAGTACTCTACCTTTCGATATCCCCAGAAACTCTTGACCACGCTGA
TCGACAGATTCCATCGCTCGCAAGCGTCAAGTAGTGCCTCGACCTTCTCGCAGATCGAGTCCCAGGTGTCAGCGGTGATCAGGATATCGTCGATGTACGA
TCGCCTGCCCAGCACCGAAGGTCCCGGGTTTGCCTCGGGTTCCCCTTTCTCGAACACGTCGGTTGGTTCCGAGTGGTCTCGATCAGGACTTATCCGGAGG
TATCCGTACAGAGCATTATCGATCAGCCTCTGGTAGATTTGTGGGGCGTTCTTCAGCCCGAAGGGCATACGCGTCCACTCGAAGAGTCCGAAAGGCGTAA
CGAACGCGGAGATCTTTCGCGCACGTTCCGTCATGGAGACCACCCAAAAACCACTAGCCATATCCAAAGAGCAGTACCAGAGTACTTTGTCCAAGTCCTC
CAAGAGATCGTTGATCAGCGGCATGGGATATACCATCAACCTGGTCAGGCTATTCACCAAGCGGTAGTCGATGCACAACCGGATGTCGACTCCGTTCTTC
TTAATGATGATCACGATCGGAGACGCCCATGGAGAGGTTGACGGCTCGATCATATTCGCGGACAACAAACTCTTGATCAGATCAGACAGTTTCTCTCGGA
ATTGAGGGGCAACCCGCCGCACGCGTTGGGCGATGGGAGCGGCTCCTCCAACATCGATGTCGCACACCGCACCAATCGCAGCGGGCGGGAGTGCGTTTCC
TTTACCGATCAGCAAGTGTCGTCGTCGCCAGATGATCTGGCGAAGTCGGTCGATCTCCTCAGGTGTATTCGTTTCCGGATCACCCACTTGAATGTCTTCG
ATCGTGACTTCGTCGGTAGTGGTTGGCACTTCGGGTAGGATAGCCATCTGGCTTTCAACGTCTTCCGCAAACAAGGCACCACCTTCATGGAAACACACCT
CTTCGTCTTCTGGAGTGCTGGGCTCACCA