Description :
From Genome Similarity Track
Location :
Scaffold_50:113123- 115504
Sequence
2381 bases(100 bases per row)
CTGGTGCAGCATCTTTAGCGCGCTCGACATGGTCGACGGCTATTACCAGCTGATGATGAGAGAATCGGATATTCCCCTTACGGCAGTGAGTACTCCCAGT
GGGATGTTGTGGGAATAGTTGGTCATGCCCCAGGGGCTTTCCAACGCGCCAGGCACGTTCAATCGGCTGGTTACCCAACTTTTTCGGCCGATGTGACACT
TCGCGCAGACGTATTTTGATGACATGTTTGTCCACAGCAAGTCTGAAGGGGACAAGATGGATGTTGAGGTGCATATTGGGCACCTTCGGTCAGTGTTGAT
GTGCATGCGAGAGAATCGTCTCTTTTCGAACATCAACAAGTTCCTCTTTGGGGCGGAAGAGATTCCTTTTTGGGATGTTTCCTTGGGAAGGATGGAATTT
GGGCGGATCTGGAGAAGGTACGGGCGATTGCGCAGTGGCCGACGCCCAAGTCCCAGAAGGATCTACGCAAGTGGCTGAGACCTGCAAACTATTTGCACAA
GTACAGCGAGAATTATTCTGAGATGGCCAGGCCATTGACAAACTTGCTGAAGAATGATGTGATATGGTCATGGTCGAGAGAGGCCCAACAGGCTTTTGAA
GCCATCAAGTTGAGCCTACAATCAGCACCAATTTTGGCGTTACTCGACGAGGATCGTCCGTTTAGTGTGGAGTGTGATGCGTCTGATTTTGCCATTGGCT
GTGCGCTACTTCAGCTGGATGCCAAGGGCAACGAACGTGTGATTTCGTTCCAGTCGCGGCAGCTCAAGGCCACCGAGATAAATTACCCAGTGCATGATAA
GGAACTTCTTGCGATGAAGTATGCACAGGTCAAGTTTCGGGCTCATCTGCTAGGCAGTAAACCCTTCGTTGTCTACACAGACCATGCCTCGTTGAGGACG
GCGACGCAGTCGCCACACTTGTCGCAGCGCATGGCGCGTTGGTTGTCATTCTTTGCAGAATACAACTTCACGGTGGCTTATAAGCCAGGGAAGGAAAATA
CGCTAGCTGACGCATTGTCAAGGCGTCCTGATTATGAGCTAGCACATGTGGTGCACCTTGAATCGACACTGTTTAAGCTCATACGCGGGGCGTATTCTCA
AGATCCGGACTTTCGAGGTGTTATTGAGGCACTGGGCACCTCATCGAACATCGTCAAGCTGATGAAACGCCAGCAGGCACATCTCCATCGGTATAGCCTG
TCCGATGGACTTCTGCTCTACAGTGTGAATCCTGGGGATGAAAAGCGGGTGGTCGTTCCAAACGACGAAATTTACGCCACCGGTTCCTCTACGAGGCACA
CTATACGCCTGGCAGTGGTCACTTGGGGCGAGAAAACGTATACGTCTGTGGCACGTGAATTTTGGTGGCCCCACATGTACAAATGGGTGCGGTCTTATGT
TACGGCTTGTGAGACTTGTCAGCGGGTGAAGCCCCTACCGTCTTCAGCAGCGCCGTTGCAGAGTTTGCCAGTCCTGGAGGACTGTTGGCGCTCAGTGAGC
ATGGACTTCATCTTTGATCTACCGGCAGATAGGCATGGCCATACTGGGATTATGGTTTTCGTGTGCCGCCTCAGCAAGATAGTGCAATTAGTGGCGGTTC
GCCGAAGTGTTACGGCGCCGCAGGCGGCCCAACTCTTCATTGATCATGTGTTTCGACATCATGGACTCCCGGAGTCTTTTGTGAGTGATTGGGATCCTCG
TTTCGTTTCGACCTTCTGGCAGCATCTCTTTCGGCTGATGGGGATTCGACTGGATATGTCGACAGCGGATCATCCGCAGACGGATGGTCAGACCGAACGG
GTCAACCGTGTTTTGGAAGATGTGCTTCGCAGTGTTTGTGTGGATGAGCCATCTCAGTGGAGCGCTCAACTCGCGCAAGTGGAATTCGCGTTGAATAATG
CAGTGCACTATTCTACGGGTTTTCCCCCGTTCTATGTGAATGGGTTGCGGCATCCGCATACTCTCCTATCGTTGCCGAGGGCTTCTGATTTGGATGGGGG
AGAGGCTGTGCCGATGACCTAAGAGGTTTAAGTGGTGTTCGACCATCGGTCAAGCGTAATTTGCTTAAGTTTATTGAGACTGGTGAAGCCATTCGGCTCC
GCGTAAGGGACGCCGTGGCTGCCGCTCAGGACTTTCAAAAGGAAAACAGTGACCGCAATGAGCGTCAGAACACACAGGTGTTTAAGATTGGCGATTTGGT
GTTGCTAAATGCTCGCAATTTACCTATACACGCAGTGTCGGCTGTAGGGAGTACAAAGCTTCGTCCGCGCTTCGTGGGTCCGTTCATGGTCATTGGTGTG
CATGGCAATGCTTACAGTTTAACCTTGCCATCGGCTATGGCAACGCATCCAAAGTTCTACGTTGGGATGCTTAAGGCCTAC