Description :
From Genome Similarity Track
Location :
Scaffold_2:113120- 125148
Transcript NameFunction/comments
Phyta_totarag139hypothetical protein
Phyta_totarag140hypothetical protein PHYSODRAFT_505107
Phyta_totarag141hypothetical protein PHYSODRAFT_346687
Phyta_totarag142hypothetical protein PHYSODRAFT_315958
Phyta_totarag143hypothetical protein PHYSODRAFT_354824
Phyta_totarag144conserved hypothetical protein

Sequence
12028 bases(100 bases per row)
GCCCGTCGGGTCCTCGTACTGCATGGGGCCGTCCCACTTCTTGACGGTCCACTTGTTCTCGACCAGTTCTCGGAAGAACTCGTTCGAGAACGTCCACTCG
GCGTTGGTCCACGGACCGCTGTAGCCACTGCGAGTGGGGTAGCAGCGGCCAATAGCGTGGGCGCCAATGAGCGCGACAATGTCGCGGTCATCGAAGCCCA
TGCGGTAGAACACGTCGCGCACGTGCTGCGTGGTCTTTTCCTTGCTGCCCTTGTCGCCGTCGGGAAGACGGTCGTCGGGGGTCTGCGTGGGCTCCTTGCC
GCTCTTGGCATCGGGGCGGCCGAGACGGAACGGGATCTCCGGGCCTCCCATCTCCTCGATCATCGCCACACCTGCCAGCACGTACAGGTCGGCGTACGTG
ATCTCCGGGTGGTtcttcttgaccttctccagcgccttgacgGCCAGATGCAGGCCGGCGTTGCCGCCGTGGTTGATCTCCGGCTCAAAGCGGATGGTGC
CGCCCGTGGAGCCGCCGGAAGAGTCACGCTTGGCGAACGTGCCACTCGAGTGCCACGCGAGACGCACGAGCGTCGGGCCCATGTAGTTGTCCTCATCGAA
GAtctccacgatctccttcttgatggcgtccAGGTCCACGGGCTTCTCGCGCGCGTTCACCAGGTCGGTGAGGGCCAGGCCACTCACGGCCGCGACCCCC
GCGGCGGCGAGCACGATGGCGctcggctgcttcttgctggcgGCGTTGAACTGAGACGTGGCGAAGCTGCGCGTCTtggcggaggaggcggcAGACGCCT
GCTGGGCGGCGCGGAGGGCGGCACGACGGAGCATTATAGAGAGAGCTTGGAGACTTGAGACTTGGGCTCTTGGCGGAAGAATTGCGAATGAATGACTTGG
ATCTTTGATGAGGGAGACTGAAGGTCGGACAGCGCATCGCCTTTGAAAGGCCGCATAGAACTGAAAATGATAAAATGACTGGGACAAAGTATGGGTGAGT
GAGGATACGTAATGGTTGTCCGACCCCCAGAATCTGAAAGGTTTCTGGTGGTGCGCTGGAAAATACTTGGGTTTGTATGGTCTTTTGAAACGCTAGATTT
TAGAAACTGTTGCTAAAAAAACGTTGACTTGATCATAAAATAAGGCGTGTTAAACCGGAGTGTTCATACGAAAGGCGTCTTGTGTACGTTAACAAGCGGC
TCCATGCTGACAGATACAGGGCGTGAAGGTCTTATATTCCTCGCTCGTGCAAGTTCATCCGCCGGCGTCGCCATTTAGCGTGTCACAGTTAAGACAAATA
GAGATCCcgaccacttcaacctgAGCCATCCAACTTCAAGTACGTGGCGGGGATGGGCCAGCCATCTTTGGACCTCTCTGAATTCGCCGTCTTCCGCAGA
AGTCGTAATCGCTGCTGGGGCCCAAGAAGCACTAAGCCTTAGCTGACTGCACCAGGACGCACTCGTAGAGAGGGTGTGTGGCTGGATATAGCGAGGCGTA
GCTGACTGCACTCTCGAACTCAAAACCGTTCAAACAGATGCCCCAGCGACCTTAGTAGCTCAAGCAGAACGGCGTGGCAAGTACAAGagacgtcttcgtc
cactAGCCAACACAAAAGGCGACGTGTGTCATCCTGACAAGCACGAAGGCGTGCTACAAGTTGGGGCTCCTGACTGTGGAAAGCTCCTCGGCAGGAGCAA
GACATACGGCTGCGTGACAAGTGGTGGACATCGGCCTGAAAGGTATCAACAACATTACGCCAAGACGAGGCTTAAACTGCCTACTAACGTCGCGGCGTTA
TTCcgcgagagagagagagagctgcGACTATAGCTTCCAAAACGCCCCACCGTAGGCGTAACGATTCTGCCCATATTATCATTGTCATCATCGACGCAGC
CATGCCCTCTGTGGAAGGCGGCAAGATGGTGTTCGTGCCCGCAGACGGTCTGAAAGCGGTCGTAGATGGTGTTCGTGAgcagacgacggagaagcaaCGT
CTACTAGCCCGAATCGAAGAGAGTCGCAAGCGCGTGCAGTTGCTTCGTAGCAGGTCAGCGGCCATAGAGTCAAGACTGATGGAGCATCGGCAAAGGACAA
TCGGACACAGCGGCAACGGCGTTGCCCCACCTAAGGTCGGAATGAGTTCGCAGGCGTCCCCAAACTCAGCAGGAGCAGTGGATCAAACTTCAGGAGGCAT
CGTGACGATGCAAAAGCGCGTTTCGCAGCTGGAAACGCTGATGACCATAGCGAAGGAGGTCTCCGCCCAGAGCAGCTTCGAAAGCGTCATCGAGCGCACA
TTGCGAGCTGCACTGCAATTGGTGCGCGCCGACAAGTTCACGTTGGGCATCTTACACGAGCGTCGAAATGTCCTGGACGTGTTCTCCGTCCTGCGCAACG
ATGCTGACGCCGACGTGGATTTGTCATTCGCGAAGGTCGATGTGATCAATGAAGGCTTCGTAGCACCGGACTCCCCCACATTTTTCGGTCGTGTGATCAT
GACTGGTCGGCCTTTTGCCAtcagcgacgtcgacacaCATGCGATCTTCCAAAGCCAGCGAAGCCAGACAGACAATagtcgcgcagcttctcctcaAGCT
TTGTTGTGTCTACCGATCCGCAACGCTCATCATGCAGTAGTCGGTGTGCTACAAGCAATTGCGTCTGCTTCAACAGACAAACCAATCGCGACGTCGGTAT
CCTTCACCGACACAGACATCGCCAACCTTGAGTTCATTGCAATTGTAGCTGGTGCTACGATTTGGAACCTAGTGCTTTCACGCCAGCGGCAGACAGCCCA
GCATCGCATCGAAGGACTACTCAAACTGCACCGTAACATTTCCATGGAGAGTGTTTCCTCATCTGCGGTGCTAGACCaagttcttgctgtttgtcACGAA
CTTGTGGGCACCGAACGCATCGGTCTGTTCATAAAGATtgacggcgaggacgagctTTGGATTGCTAACGCAGCGGACATTGTTCAAGGGGATTACGTGC
CGATCACTAAAGGCATTGCCGGGTATGTCGCGCGCACGGGTGAGACTGTGATCACGAACGACGCGTACTCACATCCGTTGTTCGATCCGACACTGGACCA
GAAGACGGGCTTCCTCACCAAGCGGATCTTGTGTCTGCCAGTTAAGTCCCCCGAAGGGACCATCTTAGCAGTTCTCTCTGCAGTCAACAAGGTCGACGGG
ATGGACTTTACGAGCGAGGACGCTGTATTTCTGAATTATGCGGCCGAAGCTGTGGGTACGTCGCTACACAAGGCGAGTTTGCATCGCGAGGTCAGGACGT
CGCAAaagctgcttgaagcacGACTGAAACTTACGACTTTCATTTCTGAGAGTACCGATATTGCTGAGTTCGTGGATATTGTCATGGAGTTGGGCAAAGA
TATCATGGAATGCGACCGCTTTGGCCTGCTGCTTATTGACCACTTCAAACATGAACTTTGGATCACACCGCGCGTGGGGGGTGAGAGCTTTCGCTCTCCT
ATCAATCGAGGGATTTCAGGGCTTGTAGCAACCACCGGGGAAACCGTTTGCACTCGTGATGCCTACAAGCACGAACTATTCGACCCGAGTGTTGACATGA
AGACGGGCTACCACACCACGAGCGTACTTTGCATGCCTGTGTTCGAAGACCATTCACTCACGATTCCTCCTAAGGTGGTAGCTGCCGCAATGTgcatcaa
caagaaggaAGGCGCCCACGTCGTGGCATTCACTAAGACCGATCGTGAAATCATGAATAAATACTGCGCAGAGGTGCAGTTTGCACTCGGTCGACTATCT
CTTGACATCTCGTACTACAAGGTCGTATCAGACTGTGTCGCCGTCTCTCGCACAAATATGGACCCGAGCTCAAGGACTTTGAAGCGAATGTCAACCACCA
GCCGCATGGACAAATATTCCGAGACCGACATCATTTCATCCATCGTGCACAAGTACTGTCATTCAGGCGACAACGGGGGAGGAGTGACCAAGAAAAAAGG
TTTATCCACCttcgcagcgctgctgccggcCATCAAGAAAAAGAGtcatgaagatgacgaagtACCATTTCCACGGGAGATCGTCTTCGCTCACGGGCGA
GATGAACCTCTGGATCATTGGGACACCGAGACGGTATCACTCTCGAGCAGCGAAATGTCAATGAGCTGCGGAATTATCTTCCGCGCGTACGGGTTCATGG
ACGCATTCCGCATCTCCAGTGAGAAGTTCTCGGCATTCACGACAAACGTGGCTAACTACTATCGCAGCAACCCTTTTCACAATTTTCAGCATGGGTTCCA
AGTATTGGTGGCCATGCACATCATGCAACGTTCCGAGTGCCGCCGGTACTTTAGTGGCCTTGAGATTTTCGCCATGCTCATTGCATCACTGTGCCACGAT
ATCGACCATCCAGGAAACACCAATGACTTTGAGCTCAAGATACTGAGCCCTATGGCGCTCACAcacaacgacgacgctgtACTAGAGCGCCACCACTGTC
GTGTGACCTTCATTATCCTCAATCACAAGTCCGCCAAGATCCTACAACACCTGGACCATGAGCGCCACAAACGAGTGCGGCAGCTCATCATTGCGTGCAT
TCTCGCGACAGACATGTCCAAACATTTCGAGAAGTGCAAGGTCCTCGAGGGCCTTACGCGTCGACAACTCAGCGACAAGCGTCCAGTCCTTATGGGTATC
CTGATGCATGCTGCCGACCTATCTCACTACGCGCTGCCGTTTACTCAGGCTCAGGAGTGGGGTGCTCGCTTGCTTGACGAATTCCAAAACCAAGCCACTA
CCGAAGCCGAACATGGAGTTTCCACCGACTTCTTTATGCAGAATCTGGAGAGCAAACGCGTTCGGATTACCGTGCATCTCAACTTCATCAACTACGTTGT
GCGTCCAATTTGGCTTCCGCTGACTTCACTTTGTCATCACCTTCGGGTAAGTTGTGTGTGTTTTCCTTTGGGTTACCGTATCGTTTCACTCACTTAtggc
ctgctgcagttctacACAGACTCGCTTGAGAAAAACTACGAGATGTACAGGCAACAACTGAACAAAGAGAAGAGCATAGCCAGTGTACCAGTGAAcccat
cgacagcaacgctTCCAGGTGCACCGATGCCACCTCAAAATGCTAGTAGAAACGTGTTGCCTTCCTCCCCTCGCAACGCGCACAACGCCAGCTGATCACT
GTTCCTGAATATTGTAAATGGAGTTGTAAGACCTTTGTTAAAGTGTTCCTTTATGCTCGCGGATTGTGCATTCCGTCATGTACATCAAGGCTACTCGGCA
AGACGTAGCCTCAACTCACTCTAGTCGAAGAACAGAACGACCACCGTGGTGTCATcgtggcgacggcggcggtggcttcCCGGTGGcaggctcagcagct
cctggtaCGTCATTCCGTAACGCTTCGCCGCCTTCTGCAGCACACGCTCAACCAGCGCACGACCCGCAAGGTCATGGTTTCCGCACGAAGCCTGGCCATT
GACGACCTCCACAGCCTCTTCGTTGCTGAGGTAGTCCCACAGCCCGTCCGAGCCGATAATGAGGAACTTGTCTCCCTCTGCGAGCTTGTGCGACTTGATC
TCTGGGATAGCAGTGATGTAAGGTGGAGTGTAAGGTGCCGAAAAGTGGCGACCAGCAGAGCGATCGCCATTCACGTAAGGCGGGCCGTTGAACTCTGGGT
ACTTGAGCGAGAAGTCTCCGAACGCGCGCGTGGGCTGCAGCGCGCCCTTCACGTAGCACGAGTCCGGGTGGCGGCACGTGAACGCGTTTGCCTCGCCCGG
GtgcttcttgatgagctTTTCCTGTTCGAACTTCACCATAGCGTTCTGGTCCTTGCTGAGTGGTTCAGCCACGATCGTGTCGGCACCCTTGCCGAGCTTT
CCCAGCACCGCGCGGATGTCACCAGCGTTTGCAACGTGAACGGTGCCTTCGTGCACGTAAGCCAAGCACGCGCAAGATCCGCAACGTGCCACGGCTCCGA
ACCCCAGCTTGAATGCCGAAGCCACCTCAGCCATGAGGTCGCGGTCTGTGCGTCCGAACGCACGTTGGATAGCAGCTGCCACGCGCTCGTCCGAGACCGA
GGTGTCGTCACCTTGAGCCGGCTCGTTCGTCCCCGGTTTGTACAGATACGATAGCTCCTTCTGCACATTGCCAATCAGCGTCTTCCTGGCATACTCGGAC
ACCTGCCAGCCACctacaagtacaagtacaagttAAAAAGGTCAAAaaggtgtgtgtgtggggggggggggggggaggggaCAAAAAAACACTCAAGCTC
AAATGATGCCGCACCATGGCCATCCAGCACGGCAGCAAACACGTCACCCGAggccgtcgtctccaccgcGTACTTGTCTTCAATGGGGAAGTTGGCCTTG
TACGACGCGCTACTGAGCCGCGTGGCGCGCGACTTGGCGATGGGCGCGAACTCCTCGCGCTCCAGAGGCACGGAGAAGGCTCCGTCCACCTCGGGCGGGG
CGTATCTGGCATCGCACTGCGCCTCCAAGTGCGCAGCGCCCACGTCCGTGAGCTCAGCGTGAGCGAGGGCCAGCACTGACAGTCCCAGCccactcagcag
cagcgcctgaCGCAGCATCGAGCCATGAAACTGAAGCGAGTTTGACAAAAGAGGAGTGAGTTTCGACTGAAGCTTGTAGGGGGTCAAAATTGGTGGGAGA
AGCGGCGAAATGCAGCTGAGAGGTAGGAGAAGCAAGGAGGGGCTAAGCGTGCACGCACCTTGTGGCTATGTCCACGCGCCAAGCGCGCCAGGTTCCGTGC
TGCAAAAAGTCGCATACTTGGGTCAAAAGCGGATAAGGACACACAAAGGGGGGAACTGCGCTCTGATTGGGTGTAATGAAGCGCAAGTTTCgtgttgttg
aagtggtcggCCCAATCGACTTGGTAGACGAACACTGTTCGTCTACCAACAGACTCTGCTTAACATAGGATACTTTGTCTGAGCTTCTAATGTCGCAGGA
TTCTGAACGGagaatcagcagcaaacacaacAGACCCGCAAAACGCTTGGTAGGGCGTACGCTGCACTGACGACCACGGTCGACGTTTCGCGATACTGCT
GGCGGAGGTGCAGACGCATGGGCTCTTGATGAGTGGATGTACAATACTGAGCTTGTCCACTCGTGGGGCTACTCGCCGGTATGGTTCCGTTTTGGAATTC
GAGAAACGCTCTCGTGCGTAtttgctcctgctgcttgcccGAGTGTGACGGTGCCGGGCTACCCGTCCGCGAGCTGGTCTACACGAAGCTACGGTTGTTG
TCCCTACAGTAATACGCAAGACGCTGGATTCGCTTCCTCCCCCAGCGCCGCACACTCACTCCGCTTGGGTTCAAGTGTGTGGATCGTACGACACGTTGCG
TCCCGGCTCCGGCGGAAGTCCTCCGAGTTCTCCGACGAGCAAAAATGGAGGTCAGGAGCGTTGAGCTAAATCGAAAATTACCAACTGCCACAAGCCAGAA
AACTCGAGAAAACACAACTGCATTGCCCTACCGGGCCCGCCGACTGCTTCTGGCCTGTCGAAGAAACGCGGAAGGCGTTTCACTCAATCCAGTTGCGCCA
GGGCTAGCGGCACCATTAGTCATTTTCGCTCGAGACAGAGGACAATAGCTACCAATTGCTCTGCCTGTAACACCGCGTACTTTTGCAGCATCGACCAACA
AAAGTAGCGATCTCCATTCCTCCGAACACCAAATCAAGATGGCGGCGGCTGATGACTTTGTGCTGCGCCTCGTGGACTCGGCCGACTGGGTCGCCGACCA
CGAGCGCAACCTGTGCTACGTCTGCACCAGACCTTTCGGCACATTCCGTCGCAAACACCACTGCCGCATGGTAAGTGTCTACACCGACACTGACGATAGC
TCTACCCCATTTCCAGATTTCTAACGTTGTGTCTATTGCTGTCGACGCAGTGCGGAGAGGTTGTTTGCAAGAACTGCACGCTCTACAAGGACGCCCAAGT
GGACCCGACGCTTGACCCCACGCGTGTTCGTGTGTGCATGTCCTGTGTCATTAACAACTGCAGCCAACGCCCAGGTCGATCGCTCAGCGCTGCTTCACCT
CACCTCAGTGCGACGTCGGAGGCGTCTCGATTGTGGTTGCAGAGCCACCTGCACTCTCCTGCGTCAGGCCCATCGTCCGAGCCAGACAGCGAAGAGCTGC
AACTTCGTTCATTGACACCCAAGTCACGCCGACATTTTGAGCTCAAGGACGGCCACTTCAGCGCAGAAGGCGAGTCTAGAAACCCCCGCAAGAGCAGTCT
GCAGGCGGAGCAGCAAAGTAACGAACCGCCATTCGAGTGGGCTCACCCGTGGCCTCGACCACCGGTGAGCACTGACGAAGGAGAGCGACTCCGAGCCTTA
TACGCGCTGCATGTACTGGACTCTGAATCGGAGAAGCCCTTCGACATGATCTGCGACCTAGCCAAGGCGCGTTTGTCATGCCCCATGGCCGCAGTGAGCT
TTTTGGACGAACACCGTCAATGGTTCAAGGCTAGCGTGGGTTTAGCACACAAGATGATCCCGCGCAAAATCGCATTCTGCGCCTACACAGTGTTCGTGCG
CGAGCCGATGGTCGTATTGGACACGCTTCAGGACCCTCGCTTCCGAAAAAATCCGCTCGTCTCGGGTGCTGCCGGCGTCCGCTTctacgctgctgcaccg
aTCATCGACCCGAACTCGGGACTCGCCGTCGGGagcgtcttcgtcctggACACACGTCCTAGGGAAGCGTGCGATATCTCCATTTTGGAACGACtagcac
tggcagcaggtGATAATCTTCCAGAGGTTGCATCAGTTCCCAACAACCAACAACAGACCGATAACAACGCAGTCGACGAGTCTGATAGGCATCAGGATAA
TGAGCGAGACGTCATTGCGGATCTTGTTGATATTGCGGCTCAAAATGAACTCCAAAGCTTTGgcaggaggaagatgagggTGCCGATGtctccagcgacg
tcaaTTTCAACATCGTCGATGTCATCAGTGGCTTCCGGGGCGTCAACTaaagcgtcgtcgtctccatccacGCTGGACAACAACGAAGGCGATGGAAATC
AGGAAGGTGACACGTCGATGGCCATGACGCAGCTTTCCATGGGGACGACTGCCGCGGGTGAGCAGATGGAAGTGCTCCTCATGCGTCTGCTGACACAAAA
CACagagacgcagcagcaactggcaGTGCAGCAGATTTCGCTGTCCACGAAGCTGGGGCAGCATACCGACCAAATCAACAAGCTCATGTCCGACTTTGCC
CGAATGGAGGCTAAGGTCGAGGCCAAGGTCGATAGCAGGACGAAATGAGaacaacaaacaaacaaactCAAGGACCGACCCCTTTTTCGTTTGTGATCGC
GATGACCCACGTGAAGTTAGTTCTCTCGTCAGCATCCACCGTTGGAAgtggtcgcagcagcattgtGCACGTCCTACATCGACAGCTTGGAGTGCGGGGT
CTCTCTTTTGTAGCCGACGATTACGAGAGACGCATTGTTTATTGAGTTCGTCATGGCGCTATGTAATCTATTCAACGAACCAACGCGGTGGACTCCGATG
TccatgctggagctgttgaGCTTGCTAATAGCATCTCCACTGGTCGACGTGCTTCGTCACACTCCAGCGCCTTCGACACACAGTCGTGAAAGCGCGCCAC
CGTTAAGCAAGCAAGTACTATGAAGTATGAGGAGAATACAATTGTCTTCTGTTTACATTTTTATGGGCTTTTACGAAGACGTCAACGACTCACACGTGGC
TGAACTAAACCAGGCGCCGGGTCTATTGTTATAGCAGATTGTACCAGTCCACGCGTCCAAAAATGCACCAACTGGAGCCACCAACAGATGAGAGCGATTG
AAGTTGCTCACTACTGCgcaagagaaggaggaaaaCGCTATAGACGCGACCTAGCAGCCGGGCTTCAGGCGTAGACGGCCTTCTGTTTCTCCACCTCAGC
GATGTAGGCCTTCATGGCGTTCTCCGTGGAGAGCCCCTTCTTGGCGTTCCAGGCGTTCCACTTGGCCTTGCCCGTCAGGTCGAACATGCCCGGGGCGGTC
GTCGTGTTGTCACCGATAGTGGCCTGCTTGTAGTAGGCGTACAGAgcgagcttctcgtcgttggTCTGCAGACAGAAGAGATGATACACACCGGTCAGTG
CACCTAACAGTAGAGCTTTGCACACAGCGCGATAGACGTACGGGGCTCTTGGTGAACGTCTTCACGaacgcggcggcggcttcgaaATCGGTCTTGAGGT
CAGACATAGCGATGGAATGGCAGAGTCAGGGCGGGAGGGTGCGAACACAGAGAGGAAATGGCGAATGCTCGTCAGTGGGTCGCGGTGGGGGAATACTATC
GGTATAGACAGGAAAAATCATCCATACCGAAGTTAAGTGGAAAGGTGACACACGCGCTTTGGGACAAGTGACGTGGCTGTCACTTCCATGTCACTTgcac
ttgcacttgcagtTAGGGCAACTTGCCTTACTTGTGTTGCGCCGAAGTTGTTGTAATGCTTACGTTGCGCTTGACCAATCTGCAACTTTACACTTTATTC
TGTCTTTTATCGTACGCACCTCAACGTCCTCCGCTGTACAACCGCAATACTTTATCCAAGATATTCAACACAGGCGGTTTGCTGTCCAGTCAAAGTCACG
CCACAAAAATGCCACACATGGACAGTGTTCGATTGGTGGTCTCCAGCATGAGCGCCTTTATCCGCCGAGACTGTGCTTTCTTATCCTTCACATGAGCCAT
TTCAGATTCTCTACTTGCTAGCGAGTGGAAGAACAACCGGCAAAGTATGGCGCTCGAGCCGCTCGAATTCCACGATGTGGTCGTCATCGGCGCCGGCGTC
GCCGGTCTGCGCTGCGCCAGCCAGTTGGTGCACGTCAAGGGCGTCAAGGacgtgctggtcgtggaGGCCTCGGACCGCGTGGGCGGCCGCGTGATGAACA
CTACGAGCTTCGTCCCAGGCATGAGCATCGAAGTTGGCGCCGAGTTCATGCACGGCGCCAACACGACGCTCACGCGGCTTGCCGAGGAGTACAACATTGG
TCTACGCGAGATCTTCACTTGGGCTCAGGTGCGGAGAAATTGCCACTTACTGCATATGGATAAATTGCATTGCATACGAGCTGTAGACTGTAGTCGCATC
GATTAATCAGCCACTGATTTGCTCGCAAGAGTGTGAGATAATCTTCTGGCCTTCATACGAATGCAAGAGCGAACGTCAGATCATGTTTCCTAAATTAGCA
TCTCCAGGGCGAGCAATGCGGTCTCCATCGGGAGGGCCTTTGCTCTTCTGCGTGCATTCGACGGCACAGTTCTTGTGTCGTTGAGTTTTGTACGTGTCCA
CCAGGGAGAAGTCAGTCTGGATTCATACATCCTATTCCCATCAAAATTTGTATATTGGGTAGTAGTATGTAGTTTAGTTTAAGACGAGTAATGCATACTC
TCAACTGGTCTCAATCATCTTTTACTTACGATTCAATCGGTTTATTGCGTGTACAGGGGGATGGTGGTCCAACCGAGCCCGCTCCGGATGGAGGCATCGG
CTACTACTACATCGGAGACCAGAAACGCATGCTCAAAtacgacgatgaagacgaggagtTCCTCAAGTTTAACTTGTCGGTGGCCGACTTGAGTGACCTT
GAGAACATTGAGCAGATCCCGTCTGAGAAGTCTATGAGAGATTACTTCAACGAGATCGGTCTATCTCCGTCGATGATGAAGCTGTGCGAAGCGGGATACG
CGAACACGGCCGGTGGCCCACTGGAGGACATTTCGATGCGCACTACGTGCCGCTACGAGAAGCAGTGGATTGAGCTGGAGGATGAAGGCGACTACCGTGT
CGTGCCGAGCTTCATGCGATTTGTCGAGCTTTTCGCTGAGGGCGTGACGACCCGACTCAACTGGCCCGTGGCTAGTGTGGACTACTCCCAGAGTGACCGC
ATCCTGGTGACCAGCACATCGGGCAAGC