Description :
From Genome Similarity Track
Location :
Scaffold_167:11311- 14154
Transcript NameFunction/comments
Phymu_g5917serine protease family S28, putative
Phymu_g5918hypothetical protein PHYSODRAFT_329926

Sequence
2843 bases(100 bases per row)
ctgtgtGGCGCCTCCGAGGCCTTCACGTTCCCCTCGCACGCCAAAGACGGGAAACTGTGGCAGTTGGTGCAGGAGGAAGAccagctgctgttccaggtCG
AGGCCCAGCAGCTTTGGTTCAGCCAGAATGTGGACCACTTCGCTTCGGACAGCAACTCCAGCTTCCAACAACGCTATTATCAGGTGGACAAGTTCTGGAG
CAAGCCCAATGGTCCTGTAATCCTTTATATCGGCGGAGAAGGTGCTCTGGAGCAAGCACCAGGAGGATTCGTGCACGTCATCGCTCAAAAGTTCGGAGCC
AAGGTGAGAACTGGTGCAAGTTTTGAGGCTGTGTTCATGAATTTACGCTTGTTTTATTGCGACTATTGTATTTGTCACTAGATTCTGGCTCTGGAACATC
GGTTTTATGGCAAAAGTATCCCTAATGGGGACCTGTCAACGGAGAACTACAAGTATCTGACTGTGCAGCAAGCTCTGGCGGATCTCAAGCACTTCAAGGA
GAGTTATCAGAGTCAATTAGGAGCTGATGATAGCAACCAGTGGATCGCAATTGGAGGGTCCTATCCCGGAGCCCTTTCAGCGTGGTTTCGCGTCGCTTAT
CCAGACACGACCGTGGcatcgctgtcgtcctcTGGGGTGGTGCAGCCAGTGTACAAATTCCACCAGTTCGATGAGCAAGTGGCAATGGCTGCAGGTCCGT
CCTGTGCCGATGTCCTGCGCCTCACCACTGAAGCTTTCgaggagcagctcaaaagCGGAAACGCGACGGCTGTAAAGGGATTATTTGGTGCTCAAAACCT
GGAGGATGCCGACTTCTTCTACATGATCGCAGATGCTGCGGCGATGGCGGTGCAGTATGGACACAAAGATGTCGTGTGTGACAGCATGGTCGGAGCTTTT
GAGCGAAATAACTCGCTGATCGACTCATTCGCAGCCTTTACGATCGATATGTATGGCTCTTCCTTTGGTAGCGGATGCTTCTACGACACCAAGTGCTTAG
CGAAGGACCGTGCTCGTTGGGGAGATGGACggtcgtggcgctggcaaaAGTGTTCTCAGCTTGCATACTTCCAGGTCGCTCCGAAAGAGAAAAGCCTTCG
ATCAGCCATGGTGGATCTGGATTACCACCTCAAGCAGTGCCAGACCGTCTTTGGGGATGTCGTGCATCCATCCGAAGGTGTGGATGAGATCACAAAGCTC
TACGGAGGAGACCACCCGAACGGCCACAAGATCTTTTTCTCCAACGGTGGTGATGACCCATGGCAACGCGCGTCGGTGCTTGAGACGTTGTCGGACGATG
AGATCGCTAGCCTGGCTAAGTGCAACTTATGTGGACACTGCGGGGACCTACGAGCCAACCCAGACGTCCCTGAGCCTTTGAAGAAGCAACGCGAGCAGAT
CCTTGAGTATCTGACGAAGTGGCTTGGAGCTTCTGATAAcatggagatcgtggagaatGTCGTTCATGATGCTTTCGTTCCTcaagaggaggacgaagcc
GAGCAAATGGCGGGATTACAGCTCGCTGGACTGCACCGATCGTCGCCACTGGTCCTAATTCCCATCGTTGTCGCATTCCTTGCGTTGGTGGGAGTTCTGC
ACGCTGACGTCGTTCGAGATGCTCCGGGCGGGATGGAGATGATCCGGTACCGCCTTGCACACAGGCACGAGTTTTAAGCCCTGAGCGCCTTGCCTTTGCA
AGAAAGAAAATGAATAAACAAGTCCATTCTAAGCCTGTGGGGTGTCTATAGCACACGCGTCAATATTGAGGAGTCTCGTGATCTACACAGTCGAGAATTA
TCAAGCTGACAGCGTCTgtgtcttggtcttcttgggTGGTGTGGGGGCTGTGGACTGGCCCATCGTCTCTTTTGTCGAGATGTAGGCGTACGTAGCACCA
CCGATAGATACAACGACGATACCGATGGCCTTCTGCACGGTGATGACGTCGTGGTTGATGAGGATGGACATGACGATCACGACCACCTGCTTCATGTTGC
CGCAGACGCACAGCGTCACTGGTGACGTAACCTTGTTAGCCATGAAGCTCGTTACGTTCAGCATAAAGCTGATGACTCCCGTCAGGACGAACCAGAAACT
GGCGGACGGCACCACTTCCCAGTTGTTCATGATCGTGTTCACCTCGCCAGTCAGGACCATGGTGATGAGGCACCAGAAGGCCGACAGTGGGGCCTGGTGA
AGGATCAAGTCCACAgggtgcagcttcaggtcTCCACTCAAGAACTGCATAACAAATAAACCACCACCAGTTAGTGCACTGTTTCAACGTCTCACTAGTT
CTCAAAACGTACCTTGTTAGAGAGAACTGCCTTCAAGCCAGCAAAGATAATAGCCACAACCGTGATGATGAAGCCCAATACAGTGCATGAGTTGTCTCCA
GTACACGCCAAGTACACGCCAAAGGCCACAGGAACCAGCGACAGCTTCCGCTTGAGAGAGTACGACTTGCCCAAAATGAGCATACTGAGCACAACGACGA
CGGCCGGAACTAACGCGCGCATGACCTGGTTGAAGGAGATGGACACGAGTCCAAGACTCCAGTTGCCCGTGATGATGTTGCTCACGAAAATGAGCGAGAA
GTAAAccatgagctgcttctggccgGCCTTGAGCGGCTTTCGCTCGATGCCGTGATACACGTGGATGTACACGAAGGCGCCCAGCGTATTGCACACCATG
TGCACGAACGTGAGCGTCACCGGCAGCCGCAGAGCGCCCAGAGCCTTCTTGTTCCAGAAAGTCACGCCAATGTTCTGCGTGAACCACATGCTGAGCCAGA
AGACCACGACGGACGGCGCCACGTACGACGTCTTGGCCGTGGC