Description :
From Genome Similarity Track
Location :
Scaffold_57:113102- 122723
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G013998Protein of unknown function
Pytul_DAOMBR144PYU1_G013997Similar to HAC12: Histone acetyltransferase HAC12 (Arabidopsis thaliana)
Pytul_DAOMBR144PYU1_G013996Protein of unknown function

Sequence
9621 bases(100 bases per row)
ATGGATTCGCAGCCTTTTATTGGAGATTTCGGCATGGGCGTCCCCAATGACAATCGCTACATGAACCAGTTCAATCTCGGCGGCAACGTAATGGATTTGA
ACACCACGGGCCTGGATTTCAGCAGTGGTATGATGATGATGGAGTCGACCTCGATGCTTGGAGGATCCGCTGGATCGTCCGCTGCGGCGGGCATGATTGA
CTTTCCAGATGAATTGAACTCACCGACGGGTGCTTCCAGCAGTGCGAGTACGTCTCTATCTATGTCGGGTCCAATGTCGACGACATCGTCCACAACTGCT
GACGCCATTCCGTTTCCAGCATCACTGGCAAATGAGTCGCTGACTGGCATCCAGATGGATCCGATGATGAATGCGGCGCTGCCCAATGGAAACAACCGCG
CGATGCCAAACAACAGCATGGGGATGGATATGATGGGCATGGGTCTCAATGGGAACATGAACGTCGGCATGAATCCAGGCATGCAAGTGAACATGAATGC
CGGGGGATTTGTGTCCGACGCGACCCAAATGTTCATGCCAAACTTTAACATGCAGCAACAAAACATGATGATGAATCCGCAAGCGCAGTTTTATTTCCAG
CAGCAGCAGCAGCAACAGTATCTCCGCATGTTACAGCAACAACGCAACTTTGCAGCGATGCAGCAGCAACAGCAGCACGCACTGATGCAGCAACAGCAAT
TACAGACACAGCAAATGCAGCCGCAGCAGATGCAAGCGCAACAGCCCACAGCGCAGCCAGTTCGTCAACAAACGCCTCAGCAGCAGATCCCAATCCAGTC
AACATCAGTGGCAATGGGGAATGCGCAGCCAGTCCAGCAACCAGTGCAAGCGCGGCAAAATCTATCTCAGGCGATGCAGACGCAGCCTCCAGCGGCAACG
TCCGTCCAAAGGCAGCAAAGTGGAGCAAGTGCTGCACCAAAAGCTCAAGCAAGTGGCGCTGGTGGGGCACAAACAGCAACTGCTGCGTCAGGTACCCGAC
CAAACTGGCATTCTAGTGCGGATCAAGCACTGCGAAAGGAGATGCTGAACCATATCATGCGCGTGTTGCGCAGTCAAGGCTCCAATGCGCCACCGAACTG
GCTGCAGAAGCTTCCTGAGATGGCGCATCGCTTAGAGGACGAGTGCTACCGAATAGCGACGTCGAGAGAAGAATATGCCAATACAAGTACTTTACAGACT
AGACTGAAGAATATCGTACGCGCAGCGCAGAGCCATCAGCGCAACCGTGTAACTGCAACACCGAACGGTACAGCCGATCCAACTGCCAAGCCAGCAACTA
ATACTGTTTCTGCGCCTCCCCAAGTGCCAGCTGCAACCCCGATTCCGTTCCCGGGTGCTCAGGCAGTCTCGACGGCGTCACCAGCAGTCAAAGTCCAAGA
TGTATCTCAAGCGATTCAAATGCCCCCAGAATTGCAAGATCCTCCAAAGCAGCACGTGAAAGTTGATCCGAATCCGCCAACTCAGCCTACCTCAACGTCA
TCAGCTATCATTGACGCATTGATGTCGGACAAACTATCGACATCCGAATCCAGTATCTCGCCGTTGGCGCAGGCTCCGGTGAGCACGCCCAACGCGACGA
GCTCTGCTGCAGCTATCGCGGCAGCGAATCGAAGCCGATCAGCACAGATCATTCGACAGTTCAAGGCAAAGGCGCAGCAAGTGACGTCTGCGTTGGATGA
ATCCCAGACTACGGAGTACCACAACAAGCTACGATCGATGACTAGTAGTGACCTCAAGACTGCGGGTTCGAAAGAAGTCCTCCAACGCCAGCAGCAACGA
CTTTTACTTTTGCGTCACGCGATGTGGTGTAAGGCGAATGAAGGTTCCTGTACAGCGACTCAAAACTGCGGGGAAATGAAGCGGTTGTGGCAACACATGG
GGGCGTGTCAGCATACGAATTCATGCTCGTACAGCCACTGCATCTCGTCCAAGTATGTGCTGTCACATTTCCAGCAATGTGTGAACCCAAAGTGTCTAGT
TTGTCAAGTCGTGCGATTTCCAGTGGAGGTGAAAGAAAAGAATGGCTCGTTGATGATGGATGCCGATAGAGCGCTGCAACAGATTTATGCTGTAACGCAA
CGCCGCAATCAGCTGAATCAAGCGAATGCGAATCAATCCCAAGTGTCTTCTCACCAGCAAGCCCAGGCTCCAGGAGCTCAAGCGCCAATTCCGATGCCGC
TGCAATTGCAACAAAACGGCTCGCAACCGTTCCAGCAGACACAGGTAAACCCGCCTGTGACTACGTCTGGAAATATGATGACGGCGAGTATGAACACCGT
GAATGTGAATGGGCTTTCGATGAATCAACAGATGAATGGAAACCATAATGCGATGAATGCTGCATCGGCTTCGAATGGAATGGGGCTGCACCCTACTGTT
CAAAAGCCAAACTCAGTCCAGAATAGTCCAATGCAGTCAGGAAGAGTGGCAGGTCAGAACCTGGCGACCCCACCGGCTAACGCGCCAACAAGTGCGACGT
CGACCTCGAATGACGCATTTGCAGCCGGGTTGACAGAAGAAGATCGCAGACAACTGGCACTGGTCCAGCAAAAATTGCTTGGATCGAGTCTCGAACAGTT
GAACAGCCATTGCAAACGGCTTGAGACGTTGGCCGAACAGATTCGGACCGATATCAACTCAAAGATGAATGAGTGTCGTCAGCTCTTGCAACGCTCTCAC
ACGACACAGGACCTGAATGTGAAGAGTGAGTATGAGAAGCAGGTGAACGAAAAGCGTGTTCTTCTAAAGACCCTTGACGCCAAGGCGAAGCGATGCAGCA
GTCAACATCGCATTGTCAAGCACATCATCAACACGCGAACAGCATCGTCGTCGTCTTCTGCTGCGTCAGGGGGCATGGCTTCTGCTTCACGTCCTCCTAC
TGTCGGCACAGCACCAACGCCGCCAACGAGTGTAGCTCAGCTTCCACCGAGTGCGATGCAGCCGATCGCGATGCCGCCTCACATCCAAGCGCCCGTCCAG
CCGTTCACCTCTCAGCCTCAGCAAGCAGTTCAAGATATGCCATTAGTACAAATGCCGTCACAGTCACCAATGATAATGGCCTCGCAAATGGCAACAACGC
CAGTCGGCCAAAGCGTTCCTAAGCAGTCGCCTGACGATATTTTGGCAGAGGAGATTCAAATACCCATTGGTATGACTCTTGGTGCTGCTGGGAAGCCGTT
GGAGATGCCTCCTGATTTGCAAGAGCCAATGACTGCGAACACGTTCGGCGCCGCTAGTGCTACTGTTGCTGCCGTGTCTGGCGCTCAAGAAAAAGTGATA
AAGACAGAGGCGTCAGCCCCCGGAATGGGTTTTGCGAACGGTTCGGTTCCGCAACAAACGCCATTGAATCCACCTGCGAATGCAGGTGTCAAACCCGCTG
CACCGCAGGTCAAGGAAGACGCAATAAACCCGCTCACCATGAACAATTCGAAGTTGAATGCGATGATGAAGGAACACCAGAGGATGGATAGCGCTGGTGT
TGTCAAAGTTGAGCCAAACAATGCAGCAGCTGCTGCACCAACGGCTCAACCAGAGAACCCGCTTGCGATGAACGGAGCTATCGTCCCAGCTGTAGGTACT
AGTGCGGGGGTAACAACGCCGTCGGGAACGGCAGCTACTGACGCACCGACGTCCATGCTGAATGAACTCAGCAACGAAGACCTGGAAGCTCACATTAATT
CATTGACCAAGTATTACAACGCGACGATGTCTCCTACGCTGCTGAAGAAACGATTGGAAGGGTTGTTGAAGGGAATGATGGAACACAAGTTTGGGTGGGT
GTTTAGTAGCCCCGTGGACCCAGTCGCACTCGGTATTCCAAACTATTTCAAGATCATTCGCCGTCCAATGGATCTCGGTACGATCAAGAAGAAGTTGGAT
CTTGGTATCTACAAAAACATCCACCAGTTTGCGGCCGATGTGCGCCTCACGTTCAATAATGCAAAGACGTACAACAGCGAAGAGCAGGACGTGTACAACT
TGGCAAAGGACATGCTTGCGGATTTCAATGCCGAATTGCGCAAGCTCGAGGTAGAAGTGAACGAAGAGGAACGCGCCGTTCGCGAAAAAGAAAGCTCGTG
TCGTCTATGTGGTGTCGAGAGATTGGTGTTTGAACCTGCAGTGCTATACTGCAATGGTGAGTGCAACAGTCGTATTCGCCGCAACTGTTATTACTACACA
TCGTCGGACAACAAGTATCACTGCTGCCATCCTTGCTACGGCAATCTGGGAGATAGTGTCAAGCACAGTGAAGGACGCACGTACAAGAAAGCCGAGCTGT
CTCGGAAAAAGAACGACGAGGTTCACGAAGAACCATGGGTGCAATGTGACAAGTGTAATCGATGGGTGCACCAAATTTGCGCATTATTTAACGGAAAGAT
TGATGCCGAAAAGAAGCCTCAGCAGATCAAATCGGAGAATTCGAAGGGAAACCCAGGGACTTCTTCAGCAGCGTCAACGCCCTCAAATGGCTCCAGTAAT
AGCAAAGATGGGAATGTTGTCTCAGCGCATTCGATCTCGTCGACACCTGGTAGCGAGTTTTTGTGCCCCGAGTGCCTTCTTGACCATCGAAAGAAAGAGC
CACAAAAGTACAAGATTGGCCGCCATGCGTTTAATGCCAAGGACTTGATGCGCACGAAACTATCGGACTTTTTAGAGCGTCGCATTTACAAGGCTTTGCA
AGATGAGCGAGAGGACGAAGCGAAATGGACGAACCGCGACGTGAAGGATGTACAGACCGTCGAATCGTTGACTGTGCGTCTCGTGTCGAACATTGAGAAG
CAGCTCATGGTTCGCGACAAGATGTTCCAGCGGTACAAAGATTCGCACAAGTACACGTACGAGCACCGATTCAAGTCGAAGTGCATTTGCATGTTCCAGG
AAATCCACGGCGTGTCAGTTCTTCTCTTTGGGATGTACGTTCACGAATTTGACGAGCAAGAAGCCGACTGCAACTCGCGCCGTGTGTACATTTCATACTT
GGATTCGGTCAATTACTTCGAGCCTGCACATTTGCGAACAAAAGTGTACCATGAACTGCTGGTCGCGTACTTGGATTTCGTCAAGCAGCGCGGGTTCCAC
ACGGCGCATTTGTGGGCATGTCCTCCACTCAAGGGCGACGATTATATCTTGTATTGCCATCCAGAGTCGCAGAAAACCCCGAAATCCGACCGTCTTCGAC
AATGGTACGTGGATATGCTGGTGAAAGCCCAAGACGAGGGTGTGATCTGGCAGATTACAAACATGTATGATGACTACTGGCGCAACGACAACTCAGCGTG
CGCACTGCCGTACTTTGAAGGCGATTACTGGGTCGGCTTGGCGGAAGATTTGATTGAGAAGATTGAGTCGGAAAAGCCGAAGAAGACGAAAAAGGCTAGT
GTGAACAAGAGAAAAGCACAGGATTCGAAGAAGGGCAGCAAGAAATCCAAAGCCAAGAAAACGAAACGACGAAAGACAGGACCCAACACGGCCAGCAAAG
GCGGCGACGATGGCGACGCCAACATGTCGGATGGCGACGGCGATGGTGATGACGATGGCGATGATACCGGCGGTGAAGATAACGGTGCAGCGGAAAAGAA
GCAGAAAAGCGAGACTGCGATCACGTCGCTCGACACGGTGGACCGTACGATCACAGACCCGCTCATGGTCAAGCTTGGTGAGGTCATTGAGCCCATGAAG
GACGATTTCCTCGTCGTGAAGTTGTACCCGTGTTGCCGCATTTGCAATTCCACGGTGCTCCAAGGCGCGACATGGCAGGACACGACCACGAAGACCGAGA
TTGGATTGAACCCAAAGGTTGTGCAGACAGTGCTCTGTGACGCATGCTACGAGAAGGCCAAACTCACGCCAAAGCTACAAACTCGCTTGAACGTGCTCAC
GTGCACGGAAATGGACATTCCTCTGAAATGCACAGACCCAGACGAAGTGAACGACAGCGAGTTTTTCGACACGCGCCAGGCGTTCTTGAGCCTGTGCCAA
GGCAACCATTACCAGTTTGACGAGCTCCGCCGCGCGAAGCACTCGTCAATGATGGCGCTCTACCACCTTGGAAACCCGAATCCGAACGCGTATATTTATG
AGTGCAATGCGTGTACGCAGGACATTGTCACGGGCAACCGCTGGCATTGCCACACGTGCCCTGACTTTGATGTGTGCGACGCTTGCTACGAGAAGGAGAA
GCACGAGCATCCGCTCGAGATGATCCCAACAAGCGGCGTGAGTGGCAGCAAGGGCGGTGCCCACGGCAGCGGCCACGCGGCATTGACCGAAGAACAGCGC
CGCGTCCAGGAGAACCGCGCCAAGAATGTGCGGCTGCACATGCAGTTGCTCGTGCACTCGAGCACGTGCGCAAACGGCAGCTGCGGCTCGTCGAACTGCG
AGAAAATGAAGGAGCTGATGCGCCATGGCGCACAGTGCAAGTTGCGTGCTTACGGTGGCTGCACGATCTGCCGCCGCGTGTGGGCGCTGCTGCAATTGCA
TGCGCGTCAGTGTCGCGAGTATGAGTGCAAGGTGCCGCGATGCCACGATCTACGCGAGCACGTGCGCAAGCTGCAACTGCAGCAGCAACTCATGGACGAT
CGCCGTCGCGCGGCTGTGACTCACCAGTACCGCCAGATGAAGGGCGGCGGCGAAGAGCAGCCAAACGAGAGCGCCGAGGACGAGCCCCTGAACGGCGCAT
GATCCCGTGCGAGCAGCGAGTGATCGTGTGTAGTATAAAGTAGGAAAACGGATAGTTGCCGACCCGCGACCGACGATTGTAGTGGGTGTAGTCGTGTGTG
ATGTCTGTATTGTTATTTGTTTTTCTTTTTGCGGATGTGTAGACAAGCCAAAAACATATATAAATGCATTCAAAGCCAAGTATTCCGAAGGGGGTCGGAT
CCTGTGTGCATTCTGTTGTATTGCTTTAGCGAATTAGATACGCGGGGCACGGCTTTCGCTTTCGTCTCATTCGTTCTATCGTGTTGGTTGCATGCTCTCT
ATGACAAAACGAAAACACCTATGGCAGTCAGTCAGTTTATGCCGTGCGGCGACTGAGACGCTTCTGTCGTCGGCGGTGGTGCGAGCACGGGCGCTTGCCG
TGGTTGGCCTGCGTGTACACGTCAATGGATCATTGTCAGCGTCAGCATTGAGCATGTGTGCATATGTTCTACGTATAGCGCCATCAATGGACTGACCTTC
TTTGGGCGACGAGCGTTTCTGTTGAGCAGCTCCATGGCGATCGGGGTCTCTTCCATCAAGCGGATGCGCTCAAACGAAGCTTCAAGCGACTCGCACACGT
TGGCGAAGCGCAGTGGCGCGACGTTGCTCAACACCGTTGGCTGACGAACTAATAGACAAAGAGAGTACGCATCATTAGCCATTGCTGTCACGGCAGTTTG
CCCATTCCACATGAAAGTGTTTGTCGCGATATATCTCCACTCCTAGGAAGCGTTCCGCAATGAAAACTACATGCGCAGAAAGCTATCATCCAGCGCTTTC
ATACAGACACGGGCATAGTACGCACCGGCGGCAGCGGAGGTGAGCGTCCATGGCGCCAAGGCGCTGCGCAGAGCTGGCACGACGATGCGGCTTCCGATCA
TGTTGCTTCTTCAGCTGATGGCGCCAATTTTGATGGCTCTCGGTAAAAAACCTCGCGAAAGCCCAATTGCAATGTATAAAACCTTATATGCAAGGTTTTA
GCAGTGCCACAAAACTAAACCCAAATTTTGCAGTGTTATTCACAAATTAGCACTCGGAGAGCTATTCTAATAGAATTTGATTGGTTATAAAGATAGTAGA
ATCCAGAATGCACACGGGGCATTGGTGGAAAGTGGCAATCCCAACTGTGTTGGCAATTGTGCTGGAACGATGTGGCTTCAATATGGAGGACCAGCGTGGA
CAGGAGATGACGCGCGCAGCAGCAGCAGCAGCACTGGCGTCGCGACACATCTGCTTCCTTACGGACGTCGAGGGGAACTGGAACTACGTGCGCAACTTTG
TGCGGCAGTCGACGTGTCTGCGGCTCACTCCCACGCACGACGCGCAGCACCCTCAACCGCCAGAAGCAGTAGAAACCGACGGATATGACGAAGACTTGGA
GCTGAATGACGACTGCTTCCTCGTGTTTGGAGGCGACGCGGGTGACAAAGGCGGCGAGACGCTCAAGTGAGTCATCTCGTTTCTAGTCATTGCTGGTGCT
GATTATGAGGCTTGCGTTGTAGGTGATATTTTGCATGACTTGTTACAATCGATATTGCAGATGCTACGAGCAGTTGGTGCGGTTGAAGAAGAAACACCCG
GAGCGGGTCGTACTGCTCGCGGGCAATCGCGACGTGAACAAAATGCGCTTTACTTCTGAACTGGATGACAGTGAAATGGGCTTCAAGACCATGGCCAAAG
GTACGCCGCCCGTTTGTGACCATGTTGCTTTCTCTATTCCCCGGTGTCTAAAAGATCCTTCTTTGTTTTTTGTGCTATCTTCTGCCACTAGAAACATCGG
AAGGACCCATTTGGGTTCCTGAAAAGAAAAGATTTACGCTGAAAAAATTCCTCGCGAGTCAACTTGTTGCGCAATGCGCTGCATCGGGTCAACCCGTTGA
GACAGCGGAGGAAGAACTTGTTCAGCTGCAGAATGAAGAGCTACTTGGACCAGCAAACACGAAAGTGAATCGCCTAAAGTGGATCTTGGAGCATACGATG
GGCTCACAGGGCGACTTTGAACGCCGCCGCAAGGAGCTTGTCCGAAGACACCGCAGCTCGCTTGGAGAATCAGCTACCATCAGCGACGATGCTGTACTGC
AATCGTTTATGGAAAGCGTGCAAGAAGGAGGAGTACTTCGCGAGTACCTAGAGCTCGGGAGTCTCGCGTTTGTTGCATACAACACCTTGTTTGTCCATGG
TGGACTCATTTCTGGCGCTGGAAACGGGATCTCATCGCTTGGCCGTGTGCCTGATGAGCCGAACCAAGAATATCGATCCGTGACTGAATGGGTCGACAAA
CTGAACGCGTGGTACCTCCGTGAAGTTCGCGCATGGATCGATCGGCCGCTTTGGACCCCAGATCGCACTACAAGAGGAGGAAATGAGCTGCTAAAGTACG
TCCTCCCAGGTTACCCAGCGAGTGTTGTCATGGGTCGACATCTTGAGAAATCAGGAATGCCGACCGAATTACCGAGCGATGTCGTCCAAAGGCTATCTGA
AAGCGGCATCAACCGATTGATTGTGGGACACACTCCACATGGTACTTGTCCGACGGTGATCAAGCAAGATCCGTCCGAGGACGAGTCGCTGACTGCTGCT
GAAGCTGGCTTTGCCGAAGTCGTGATGTGTGATACGAGCTACAGCGACATGCAGGCGAGTGACAGCCGCGGCCGTGCCGCGTCTGAAGTAGTTCTCGATC
CAAATGGTCACGCCCACGTGCATGGCGTGCTGGAGAATGGCCGCCCGATTGCATTTGCAACCGACGACCCAGTGATCGGACAAATGCTGCGAGACGGCAC
GCACGTGAAAGCCAAGCTCAGCGACACTCTGAAAGGGCAAGAGGACGAGTATCTGGTGTGCTCTGTGGAGAATGGGTTCTCGTACACGTACCACTACCGC
AAGCGCCACGAACTGCAAGAG