Description :
From Genome Similarity Track
Location :
Scaffold_1813:1131- 2842
Sequence
1711 bases(100 bases per row)
ACACCACAACATGAGCAAGTCTGTTACCATGAAGGCATTGATCTACACGCCGAGGATCGGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCA
CAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCT
GCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCACGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTGAGAGGGTGAGGAAG
GTGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCGTGGGCATCCCCAGTGGT
AATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCGGGTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCA
ATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGAT
ATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTAATCGATAACGCT
CTCTATGGATTCACCCGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTG
GAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGCTGTGCGAAAGAGTGACATCCCTACTGGA
GGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACATAGGCCATCGAGTTTCCAAGGAGGGATTG
GAGGCGAATCCTAAGAACCTGTCTTCATTAGTCGATTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTC
GGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGAATGAAAATCCA
ACAAGCTCTGGCCCGGGAGATGCCGGATCCACGAAGGGATCCAAGTGGTACGACGTCAGAAGAGGACCTAAAACCGGAGCTGGATCCACCCCGGGACCAA
CGGAGAGAGGATCCAGTCTGGATAGAGACGACGGATCTGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCATGGAACTGAGGA
ACAGGATCGCGACCACGCCTATCCTCCATCATTTCGATCCGAAACGTCAGCCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGT
ACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAATTGAGCTACGGAGCGGTGGAGAAAGAGATACTCGCG
CTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGTTAGCCTGGCTGTTCAAGTCAGCCG
GGTTACAAGGA