Description :
From Genome Similarity Track
Location :
Scaffold_67:113091- 114323
Sequence
1232 bases(100 bases per row)
TTGAAGGTTGATATCTCCAAGTACAGAGGAGTCGAGGAAGAATCCCTGTTGTTATGGTTCGTCGAACTAGACAGAGCCCTAAAGGCACGACGTATCGACG
ATGAGCAAATGAAACTCACATTTGCTCAAACTCACTTGGCTGGACGTGCCAAGACTGGGCCTTAGGGCTGGAGATAAGCGACCCATGTGCTTTTGGGTCG
CTGGAAGCCTTTAAAACTCGACTCAAACAGACGTTTGAGCCGCCACAGGCTGAGTTCAGAGCTTCTGAAACTCAAGCAGGGTAAGCGTGATGTGCACGCT
TACGCTCAACATATACGACTCCTCGCGAGTAGTATAGTTGCTAACCCAGTACATGAACACACGTTGATTACTGTGTTCATGCAAGGGCTCGTAGATGGTT
CCGTCAGGAACCACCTGTTCCGCTTAGAGTTGGATACACTTGAACAAGCAATCTCAGCTGCGGAACAGGAGGACTTTAGCATGAGACAGGCTCATGCTAG
CTCGAGTTCTTATCGTCCACCGAGACGACAAGAGACTGGAGGTCCAGAACCAATGGACCTCTGTTATGTCTAGAGCGAGAGAACTCGCTCTTCGAACAAC
AAGCGATTGCAGAAGTGCAATCGCTGCTATAAGTTGGGACACTACGCTTACGAGTGTAGCGCCCCACGCCCAGTACCAAACAGTACAGAGCGAAATGATC
GGCCATTTTCCATAAAGGACAATGGGCGTAGGTCTAACGCTGTTGCGAAACCGCAACAGCGAAGTGGACCATCAAAAAATGGTCGGGGTCAGTAGGGGCG
GAGCGCCCTACTGATCCAGCAACCTCAAGAGAATTTGCAAATCTCTTGACGAAAGTTGCTCCAGATACACAATTATTGTGTGTCTCTGCACCTGGTGATG
AGGTACCACTCATCACCTTGGAATTGAAAGTGACAAATGATTTGTCACTTCGTGCTCTAGTCGACTGTGGGGCGTCGAACAACTTTGTTCGTTGTCAGTC
TCTAGAGGGTCGTAGGCTCAAGTTCGTTGAGCGCGACATCCCTCAAACGATGATGACCGTGCGCCTTGCCACAGGCTCGTCGATAACCTTTGAGAAATGT
GTAGTTGGAATCCACTACATATTAGAGGGTGAGCAGTACGATGATGACTTCATCGTACTGGATCTGGATGACAAATTTGATGTCATCCTGGGATTACCTT
GGCTCAGAAGATACGAGCCAAGAGTGAGCTGG