Description :
From Genome Similarity Track
Location :
Scaffold_91:113075- 114127
Sequence
1052 bases(100 bases per row)
AGATATTATACCTCTCGGAGATGACATGGGATCTGTTCCTGTCCGAATTAAAGGAAGGAAAGATCCACGATATAGTCGCACTATTTCCAGAAGAGAACTT
GGTGGACTGTTGCTCATCGTCCACAATGGAAGAGAGCGTCTTGGAGACTGACAAGGCAAAACGATTCGCTCCTCAAGGCTGGAATGCTTTCAAGAATAGC
CCGTTTATGTGTTATGTGGAAACAATGTGATGTGTTTCCAGCAGAAGTGCCGAGCCGCCTACCGGCCGATAGGAGCATCTGGCACGACATTGACTTGGAA
CCTGGCATCAAGTATTGTGTGACCAGGCAGTGGCCATTCTCAAAGGAACAGGTCGATAACTTTGACCTGTTCTTTCACAAGAGAGCCAAGGCGGGACATG
TGCGTGAGAGCAAATCGGCTCACTGCAGCGTGATCGTTTGTGTGCGTAAGGCAACAGGTGGTTGGCGCGTGGTTCATGCTTACAATAAGTTGAACACGGT
TACCATCCTTGCGCAAACACCGATCCCGCGGAAAGATGTTTTATTGAACTCAATGGAGAAGTCAACTATCTTTTCCGCGTTAGATTTGAAGGATGGCTAC
TACCAGGTTTTCATAAACGAGATCGATGTAGCCAAGATGGCAGTTGGCACCCCAAGCGGTATGCTGTGGGAGTGGCTAGTGATGCTGCAAGGTAAAAAAG
GCACCAGCGACATTCAACCGGATGGTCGCTCATGTGATACATCCACACCGTGCCTACTCGGCTCATTACTTTGACGATCTAATCGTTCATAGTAGGGCCG
AGGACGGATTGAGTGAGATAGAATCGCACAAACGCCGTTTAAACGTTGTGTAGCATACTCTGGGATACGCCTAATTGTACATCAACTTGCAAAAGTGCGT
CATGGAGGTCCCCGAAATACCTGTACTGGGCTGCATGGAAAAACACGGTGTTAGAGTAGACCCAGAAAAGGTTTGAGCTATTAAGGAATGACCAGTCCCA
CAACACGTGAAGGATATGTGTCAATTTCTTGAGCTTTCTAATTAATTGTATA