Description :
From Genome Similarity Track
Location :
Scaffold_226:11307- 12615
Sequence
1308 bases(100 bases per row)
AGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGCTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTCGTTCGAGGACGCAGCTT
GGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAATAGGTCCCGCGTCGCGGATACTATGAT
ATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGTCTGCCACCAACTTG
TTCGCCGTTTTCGTTGGTGCTCTCACCTGTTCTCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTA
AAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGATCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTT
CTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTT
TCCCTTGTTTTGTTAGCAGATCTTGACTTGCGTCAAGATCTGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATC
CGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCACAACCCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGAC
GACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCATGAGTCACCAAAAGATCCAGGCACGCGCACCATTGTGG
TGTAGCGGGATCAGCAAAATCTGCGAGATTGCCGGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCACCCGATGATCCGTGTTCT
GCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGCGTCCAAGTGGTGAAGCTTGAGTGTCTTGGCG
AGACGTGGGGATGGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGG
CCTAGATCGTGGATCTGGCCGTAAGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTAGTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTT
GAGAGTTG