Description :
From Genome Similarity Track
Location :
scaffold_48:113041- 116127
Transcript NameFunction/comments
g7444.t1 hypothetical protein PHYSODRAFT_496396
g7445.t1hypothetical protein

Sequence
3086 bases(100 bases per row)
CAGATTGTGTGGAATTTGCTGTCCGTGGGGATGCCTCTTGCAGCCGGCGAGCTTCTGGAGAATGCTCAGTTGACTGTACTGACACTCTTTGCTGCCAAGA
TCGGTGAAATTAAGCTCGGAACACACAACGCGATGATGGAGCTCTTCTACTTTGCCACTAGCCCGCTATACGCTGTGATCAATGCTTCCGTCACGCGTAT
TGGCAACCACTTGGGGGCTGGCCAGCCTTCGCAAGCGATTCTGGCAGCCAAAATTTGCGGGAGCTGTATCGCTGTACTCACCACCGTGAACAGTGTAGTT
ATCGTTAGTTCTCGACAGCACCTCGGTCGAATATTCTCGGACAGTCCAGAGGTCATCACGACTTTCAGCCAGGTGTGCGCTCTTGCAGCACTAGCATACT
TCATATTGGCCTTCTTCTGCTACGCCCTGGTGAGTTGAGCAAGTGGTTTCGTCATGAAGGATACAGTACTTACACCTAAATGTGAATTTTGACCACAACA
GGCTATTCTACAAGCGCAAGCACGACCGATGCCACTTGCAGTCGGCATGGTTGCTGGTGCTTGGTTGGTTGGCATACCCTCGGCTTATCTCCTGGGAGTT
CATGCTCGTCACCCCAGTCTGCTGGGTCTTTGGCAAGGCATGATATGCGGATACACGGTGACATCTGCAGCTAGCTTCATTCCGGCATTCGTAAAGCCCA
ACTGGCAGCAAGAAGCAGATAAAGCTGTGGCCCGTTCCCATCTCAAGCAAGAAGAGCTTTCTTCTCCGCATGAATCGGACCGCTTGTTAGCATAGGAAGC
GTTGTCACTTCCAAATTCCAAGGTCCATACATGCATATAGATTTCAATCGGTAAGTGCTAGAAAATCCTACCTACGCATCTGGGCTCGTGATGACCTTGA
GGCTGTCCTGCAGCTTGGCCGTGTAGCGATTAAGCGCTTCCACGATTTCGTCGTCTTCGCGTTCACGAGCCTAAACCAAGTGCATCACAATTTAAGTTTC
ATCTGCACCATTCGGAAAGCCAAAAAATGCACATGATCGAACCTGTGCTTCAGCAACCAGAGCATTTTGGATTTTAGCAATCTCCTCTTGTGCGAACGCG
TGAAACCTTTCATCACCTCGTATCCGAGTGGAGCTGTATGTGTCCAGCGCATTCTTCAACTCGGAGTACTTCAATTCACGGTCGTGCTGCACAAATGAAT
TTAATCAGCGAGACCGACATCAAACACGTAGCACAATCTTGATGTACCCTTTCACGCTCGAAGGATTCAGCCGTCGCGTGCTCATGATCGCCCAAACGCT
TCAAAATCATGGCTTCCTGGTTCGTGCGTCGCTGGCGTTCCTCCTCGAAGGCATCCATGAACGCAATGAGTTTCTGCGTGAGCTCGTTCGTTTTGTTCTC
TATCATAAGCGGAATGCCGTGTTTTTCCTTTGTAACCAGAGCCTGGAGATCATTGATTTCCTGTGTGAGATGATCGAGTCGATCATCAACCTGCTTGGCA
CGGTCACTCAGCAAAGCTTCGAAGGCTGCTGTCATGTGCGCCACCTGCTCATCACAGTAGTTCTGCAACGACTTGTTCATCTCGATCCGCTTCTTGATCT
CCGCCTCCAGTTTGAGCTCCAGTCGATTCATCTCCTGCCGCATTTCCGCCAACCGATACTCGTCTTTCTCGCGACGTTGCTAACTTGCGGCAACATCAGC
AAAACTGAAGGTTAGTCTAAGGAGTGCCAGTGGTTTGCAATCTTAAGAGGTCGCACCCGTGTGCCTATGCGCATGACGTCGTCGAAAGTGGTGAACCCGC
TCATGAGCTTTTCCAGTTTGCTGCGTGTCGCCGTCATACCGATCTGCGTTGCTGCAAGTGCATCTTCTTCACGAAAGTCCTTGCTGTCGCTCGATGCCGA
CAGAACAGCGTCTTCCGCTGCCTCTTGTTGGTTCATCCTTGACCAAATTGCAACTGATAGCGACGGTTCATGATCCCGTTTTTCCTGTGCTTACCTTTTT
ATTGAAAAGTTCTCGATGGTGGTCAAATCAGCGCCACACCGACAGCAGCACTGAAGATTGCGCTGCCCAGATCGACCACGACAACGTACAGCCGTTTGCG
TGGCCTGAGTCTGCTACAGTCTCCGAAACGGGTTCCAGCCGCAACTTCGTACCCGGTATTCTCAACAGATGTCTCCCGTACCCTGCTGTGAACGCCGCCG
GTGATACGAGTTGGGGGGGGGGGGGGGGCTGAAAGGAGCCGGGTTTCAAAGTGGAGGCTGCAAGGGCTCTGAATTAGACTCTCAAGTCTACAGCCGATCC
ACGTTGTACAGGGACGTCTGGGCCATCATGTACGCTTGATATTTCCCATTGGACATGGATATAAAGATGGGCTTCATCACGATTGGGGAAATGCAATCGT
TGGCTTGATTATCCTGAGGCCGTAAAACCGAAAATTCTCGGAGTCCTTACGTCGATTTATGACGCTGAGTACTTCATCTACTATCCCGCTCTCGAGGGTA
GCATCGACGGCACTTCGCCGAAACTAGACTATTTCGGCGATTTCGATTGCAGCGGCTACCACTCCATTTACATGAATACTCTAAAGAAGAGCGACTTTCA
GGATCTCATTCAGTGGGAGCAACTGACGGACGCGGCTCGTTCTGGCTTAGAGACTGGAGAATTTGGAGGAAACTTTCCTGTGCCGTTCATCGACGCTAAT
TTTAAGCTGAACCTTGAACGGGGCAGGTTAGAGAATCCGAATTTGTGAAAAAGAGGCGTCTTACACGAGTTTGGTGTGAATACTACTATTCAAACGATAG
CGAAGAGCTTCATGGTGGTGACGACAGCGAGCCGTTAAGGCGTTTGCGCGCTTGATTACAGATTGCGAATTGAGTTTAATAAAAGTAACAACGTCGCAGA
GCTGCATTCTGCTCGTACTACCCAATCAGTAGAAGCAAGTCTAGTATAAGCGACTCTTCACTTCTTGGAATTTCCAGCATCAGGATAAACGCTCGCCATG
GACTCGCACTCGCGCTCCTCTTCCTTCAGCGGCGGCCATGCATGCAGTGAACGTCTAACAGTACGTTGTTTCATGGACTTCAAGTC