Description :
From Genome Similarity Track
Location :
Scaffold_97:113- 8496
Sequence
8383 bases(100 bases per row)
TAGATGAATCGGCCGTAATAGTTAAGTGTACCAAGGAAAGCCTGCATCCCTTTCTTTGATTTCGGGAAGGAGAGCTCGGCGATCGCGGCTTTCTTTTTCG
CATCAGCGCGGATGCCACTCGGCGTAATCTCGTGCGATAGGAAATCAACCTTGGGTTGGATAAAGATACATTTGGGTAAAGCTAATGCTAATTCGACATT
CTGTGAACCGGGCTAGTAATCGGTCGAGTGTCCCCAAGCAGGCGTCGAGCGTCTCCCCTCCAAAACAGATACCATCGACAAACGACCTCCGCTTGAACAC
TGGAATCAAGGAAGACTGGTCTGGTTCTCCATTAGCAAACATATCGCCGTCCGGTCCGTTGACCAGGTCTTGGATCGGATCGCAGTCGGCTTGTGATTGG
TGGTCAGCTTCAAACTTCGTCAGCTGACTCTTCGTTGAATCGCTGACTCCGCCGAGCTCTACTCGCCGAGTTCCCGACTCGGCTTCAGCAATGGGCATCC
GTTCGGCAAACAACTGCCATCCTCCCTTTGGTTGAACGTATCCCCATAGAGCGTTGTCGATCAGTCGCTGGTAAATCATAGGCGCATTCTTCAATCCAAA
CGGCATGCGCAACCATTCAAAGTGTCCAAGTGCACAGACGAACGCTGAGATCTGCCGAGCTCGGCGTGTCATCAAGACTGCCCAGAATCCTCTCGCAGCA
TCGAGGGAGCAAAACCACAAGTAACTCTCCAATTCGGTAAGCAGGTCATCGACTAGTGGCATAGCGTATTCCATCGGCGTCGTAACCGCATTAACTAGTT
TATAGTCAATGCATAGCCGAATATCCACACCACTTTTCTTGAGCACTATCACCACTGGCGAGGCCCAAGGGCTGCCCGAGAATGATATCAACCCAGCTCG
AAGCAGCCCTTTCAACAACTCGTACAGTTTGCTCAAGTGGCGGAGAGGTATCCGCCGAGCTCTCTGCTTATTTGCGTGTCCTTGAACGTCGATGTCGCAC
AACGCTCCGTACGCTGGAGGCGGCAGGGCATTACCACTTGAAATCATTATTCTTTCGTGCTTTTTCAGCTCTGCCACAAACCTAGCCGACTGTGCTGGCG
TATGGCTACTCGACTTGACGTTTGCAGCGCCATAGTCGAGTTCTGTAGGCTCAACTTCAGTGAGGTCGGGAAGGAAAGCCAGCTCGTGAGCGTAGTCCGT
CAACTCCAGATCTGTCCCACTATGCTCAAAGATGTCGGTCTTACCATCGTCAACATCATCCTCTTGCTCGTCTTCGGTCGCGGCGATAGCAAAGTAGTGT
TGTCTTAGGGTTTCAGCTGGGTCTCTCGTCGAGTTACACTCATCATCTTCAGCTTGTCCTAAACCGTAGTCAATTCCGCCGGGGTCGAACACCGTCGCCG
CTGAGTTTGTTACTCCGACCTCAGCTATAGTACCTTGCAGCAGTGATACCTCTGGTAAATCATAGTTGTCCTCCGCGTCAGGGCCCGTATTCGCTGAGTT
TACTGCGATGGTCGATCTGACTCCTGCGTGGTCATACTTATTTCCGAGGTAGATGGTATCATCGTCATGCTGTCTAACCACTTCCGAACCGGTTTCAGCC
TCCATAGTCTCCAACGTTGAGTTCGCCGTAGCTGGGTCGTCGTTCGGCTTTATTCCTTCAGGTAGTAATACCTCCCGACTATCATAGTCCTTGGTCGCGT
CGGAGTTCTCATCCGCTGAGTTGGTTGTGACGGCAGAACTAACTTCCGTGCGTGCAAACGCGTCTTCAGTATAGCTGACATCCTGACGACATGCTGTGGC
CTCGTCCGAATCACTCTCGGTGTTTAGATCTGCTGACGCCGAGTCCACCGCCCCCGACTGGATAGTGCAGGCTTCCGGTGTACCCATCGCTGAGTTCCCC
ACGGCTGCAGAACTTGGTCATAATGACTCCAAACTTGGCTCGGTTGTCAATAACGGGTTGGGCGTCACGTAAGGCGTGTTCCGAGCGTTCTTCAGGGTTT
CCTTCCGTAATAGCTGAGTCTTCAGTCGCCGACACGTTTTCCTTGGCCTTACCGCACTTGTTCCTTCAACCGCTGAGCTCGTGTTGACGTCAGAAATGGC
GCCATCATCTTCAAACTTAGACAGCTGATAGGAGACATCTTGGCCCATCGTGTAGCACCGGCGTACGATCCGCTCGGACGTCTTCCAGCTTGAGCGCTGG
GTTTATATCTGGGTCACCCCTTGTCACCCCTGAAGTCGATATGACGTCGGCGTTACCGCGACGCCTCTTGTCTTCGTTGGCTTCTGTATCAGCTTCGATC
CTTCTCCAGCGCTCGGCGCAAGTTAATTCTGGTCCATTTTCCACGGGAGGGGGTCGGTTTTCCACCGCCGTCGGAATAGGGTATTTTCGTCTTTCCACAG
CTGGCGGCTGGTGTGACAACCAGTCCTCGTACAGTCGTTGTTCTTTCTGCAGCAAATCTTTGTCCATCGCTGACTCAAATGCCAATATCTGCCAGTCACA
ATATTTCGCCGAGTTCACGCGGACATATCCCTCGTTGGCCAGTACTCCGTGTGGTTGCCATTTTATCACATAAAAGTGAGGTGGGCACCAGACGGACGTC
GGTCGTACGTTCGTAATCAGGACATGGGTTGGGCTTCCTCGGCGATTTAAAATAACCGTTGGAATCCAACCCTTCGTCCATCGCACCCACAAGTCATGCG
TCGACTCACTAGGTTGCCGCCTGGGCAATTTGAACTCAGCGGTCATTCGACTTTCGATTGTTAACCCGTCTGGTGGTCCACATGGGACATTTGGTCCGAA
CTCGGTCTTGGTCGGCGCATTACTTGATCGGATGAGTGGGATCACCATCTCATCGGGTAGCTTGACCGCCGAGTTGTACAGATCCAGACGGATCCCAGCT
GGGATCATGAAGTCAGTGCCGAGAATCAAATTAACTCCGGCATGATGAGGCATTATCCATACTTCAAACTCGTATGCCACTTCCCAGCCGAGTGTCACCT
TCACAACTGCTCGTGACGCTGTCACCATTCTGTCTTTACTTATTCCTTGTATGTCGATTCGCTTATCTCGGCTGACCACTCTCTTGAGACGCAGCTTCCT
CGCGAAGTACTCACTGCTCGCCGAGACATTTGCTCCGGTGTCCAATAATATCTTGGTCCTTCGGTCGTTTACTGCACCCAATACGAGAGCTCTCATTCTA
ACTCGGCGATCAAACGTCTGTGCTGACCACCATCCCAGCCGTTCTCCCGGAAGCAGCTTCAGGATTCTGGTACGATGCACAGCGTGGTCTGACTGCCGAG
TTACACTTTCAATCGCTCGGTGGTTATCATCTAACTCACCGAGCTCACGTTCAATTCCGTCGATTTCACACATTCAATTGTCATCCCCGCTTCTTCCCTC
GGGCCGTCCTGCTTCCCTAGCGAAGGCAAACAAGAAGTTCGCCTCAACTGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN