Description :
From Genome Similarity Track
Location :
Scaffold_1405:113- 2962
Sequence
2849 bases(100 bases per row)
TCCTCGTGGCGCGAGGATCCCTTGGTCACCATAACTTTCCACGGAACGTTACCGTGTCTAGGCGGTCAACTGAGACCGCTTCGACCCATCGAGTGAAATA
GTCAGGCGAAGTCGAGTATGAACTTGTTGCCTCGAGGAGTAGCCACTAAGAGACCTATGGCGTCCACACCACTAATAGCGAGAAAGGTCCCGATAGTTCT
TGTACGGGCATCCTCTGCAATCGGCCATTTCTCCAAGGGCGATAGCCTTTACCACTGCCGCACACGGTGCATTCCCGAACATATTCGGCCACATCCTTCT
TCCACCCGTGCCAGTAAGCGTGCTTGCGCACTTTGTCGAGCGTCTTAGTAACTCCGACATGAGCGGCAAGTACATCCTTATGACAGTGATGTAGTACCGT
CGATATGAAAGGCAGGGGAATCACAGGAACTTCAAGAGTAGACGCCGGTCCAGCGCGAGCCTTCAGGTGTACGCGACGCATGAGTACTCCGTTCTTTACC
GAGTAGTTAGGCGCCATCAGCAGGATTTTGGTGCGCATTTGAGGGTCCAGAGCTAGAGCTCCATCGCTAAGGAACGCTATCATAGCTTGGATCCAGGGTG
TCCTCTTCTGTTCTTCCACGAAGCGAGTTTGTTGTAACCCGAACACATCAACGGGGGACACTAGGAGTTGGTCGGTAACCTCTTCTTCGTCGGGGGACGG
CTCGGGTCTAGCTTCGCCAGCGTCCTCGAGCAAGGTCCCTGAAGGGAGCAGAGTCGAATGGAGAGTCGTAGTCTCCCCGACTTCGACAGTACAAGGAGGG
GGCTCGTCAGCATCGTTGAGTAGCTCCGCCATAGAGATAGCATTGATGGTTTGGGTATACAGCCTGGACAGACCATCCACATGACCCATGGAAGTACCAG
GCTTGTGGAACACCTTGAAACGTAATTGAGACAACTCCATGGCCCACCTAGCCAGCTTAGCGTTGCTCGTACGATTAGTTTCGTTGAATACCCACGTCAA
AGCTTTGTGGTCCGTGTATAGGTCGAACTCGCAACGGTCCATGTAGCAGCGGAACTTGCGCGTGGCCCAAACGATACCCCAGCACTCGATCTCCGACGTA
CCGTCCTCCTTATGGACCCAGTTCTTCTCGGAGCCAACTAGTAGCTTGCTCGCATAGGCCACGACTCTCTCGCGCCCCTCCACGGTTTGCATCAAGCACG
TTCCTACAGCGAGCTTAGACGAGTCCACATATAGAAGGAAGCGCTTCGAAAAGTCGGGATACACCAGGATGGGAGGTTCCACCAGCTTACGCTTTAGTTG
CAGGAAAGCGGCCTCGCAGTCGTCGCTCCAGAAGAATCGGGCCCCTTTCATCTTAAGCCGTTCGATTGGGGCCGATATGGCTGCGTATCCCGGGATGTAC
CGCCTGAAGTAACTAGTCAAACCCAGGAACGCCCTCACAGTGTGCAAGTCGTGCGGTCTGAGCACGTTCATCACCGACTTGACCTTTTCGGGGTTGGACA
ATATGCTAGACGGAGTGACGATGTGACCCAAAAACGCTACCTGGTCGCGTGCCCACTTGCACTTTTTCATCTTGAGCTTGAATCCCGCCGACCGGAACCG
TTCCAAGACTTGTTTTAGTCGTACTAGGTGGGTAGGAAAGTCTTCACTGAAGACCACGCAGTCGTCGAGGTACACTAGACAAGTCCGCCACTTAAGGTCA
ACAAGCACAGTCTCCATCAGTCGTTCGAAGGCCGGTACCTGATTACCAAATTTGAGTCCCCACAAATCACCAGCCGTTTTAGATCTTGTCCCTTTAGTAA
ATCCAAACCCAGAAGGAGCCCGTTATACTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGAAGTCTC
CACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGGCGTACAGATCCTCATCCACCTGTACCGTCGGGATCG
GGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATTCTGGTCAACGCCTCATCCATCTTAGCTCAAGGAGTAATGCTCGTAGCCAAGACTCCCAG
GATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGGGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTG
AACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCT
CTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTTCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCTGC
TGAGACTGCCCAGTCGCTGGCATAAACTATAACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCC
ACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCCGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCCGTTGGTCCCGGG
GTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTGAT
CCGGACAGCTAAAGTGGTCATCGCAGCGAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAG
TTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGTGGGAAGG