Description :
From Genome Similarity Track
Location :
Scaffold_1906:113- 1941
Transcript NameFunction/comments
Phypl_g14359hypothetical protein PHYSODRAFT_498401

Sequence
1828 bases(100 bases per row)
GTTCCTAACCACCGCATCATCATCAGAAACTCGTGCCTCCAGCCTTTCTTGCCTAGTTCCTGAGCTGCATAGATCGCATACATTTCCTTTACAGGTAGGG
CTGCTACAAAATCGTCGATCTCGCTTGATGATCCAAACGTGCCCTCGTATTTCTGGCCAAACAGCATTACATTAGCAAACTCATTTTCGCAGAACTACGT
ACTTTCAACGTACTCGATCGTCCGGGGAATCATATACCGGATACAGATTGTCGAACTCGATGGCCTTGTCACTGCTGAAGCATTGGAGCGCCTGGTACCG
CAGCATCAGTTGGGGTTTTATACAAACTTCGTGCGTGTGAGCAGCATCAGCCCACCTCAGCTAAACGTGCGCCTGATTTGCGGTAGATTTGCTTTCCATC
CGAAGCAATCCTTTTCGTTGGTGGCGGTAGCTGACAACACACGGCAATTAGAAGCCTAAATCATTAGCGCAGGTAGCCATGTAAGTCTGCAAACCTCAAT
GCGGTCAGGATCCTGCCGATCTACCATCGTCGGTGCGATTTGGCAACTGAGCAGTGATGAATCCATCGCCACAGAGGCTGGACCCCGCCCAGCCCTGCTG
CGTGCTTTTTCGATATCGTTTGAAGTGGCACGGGCGTTTCAAGTAGCTCTATCTTCAAGCTGATTTTCAACAGTGATGCGCCCGACACAGTAATTTATCC
GTAAACTTCAACATATTTGCCAGGGTTTGATCGGTTTGTGGAGGTAAAGGAGCGAAGAGCGTTTGCTTACCCCTTTCCCTACCCGAGCCCGGTCGATATG
ACTGGCTGAAAATCCTGAATCAAAAGACGGTGTGCTGGCGCGACCCTTCACGCAGAAGGAGCCATTATGCCTCCTTCGAGGGGGTCAAAACCCACCTTCT
TTTGAAAACACCCTCAAAGGGGGCGTAATGCTCCCTCCgttcgcgaaagggttaacgCAATACGCTCAATAATAGCCCAGTCCTGAATCGCGAATATCGA
GGTGGAAAAGAGCGCGACGCTCTTCTACCGCTTAGTTTACCAGTCGAAATCTATCTACGATGACTTTCATTAGCATTCTCCGGGAGAAGATACACACTGG
CTTGCAACACTAACTAACCAGAAAGATTTTGGTCGTTATAGCTCAATTCGGCAAACGGAAACAGTCACAATATACCTTACGCTtccaaaaaaaaaactaa
cCAGAAGGTTACAGTGCTTCAATGCGTCTACAGAAGACACTCAAACCACTTGATGGGCCTCCTACTATCGCTGAATAGACTGTCGCCGTACCGGAAGGAG
GCGTCGACATGATTCAGCCCCGTCACGTAAAATGTGCTATTGGACGTGCTCGCAAATTTATCGATCTCGAACCCCATGGCACAACTTTGGTACtccacga
tgccgtcgttCTGAGGAGACTTGTGTGGAAGCACTTTAGCAGCGAGCGAGTACACAGCCCCTTGGATCGTGGTTAATCCGGTGTGGTTCTTACTGCACAA
GACAGCAGAAATGTTTGATGCGTACGCAGCTTGGGCAGAAGCAAAATCTCTGTCGAGTTTCGGGTTGCTGTAGTTCGAGTTTTGATACGTAAGCGATGCG
CGCCCAGGTTCAGGGGGGCATTTAcccagcagatccagcagtTTTCGCACAAGTATAGTCAATGCTCCGTCGCAGATTTCGTAGAGGTAGTTGGACCCCA
TGCTGCCTTCCATCGGCCCGCTCGTACCGACCCAAGTTGACGAGGAATCCAAGGTCGCCAGCCCCGATGAAATTGCTCCACCAAGCATGAGGTTGGCCAT
CGAGTGCGTGACAATGATCGTGTCATTG