Description :
From Genome Similarity Track
Location :
scaffold_1476:113- 1622
Sequence
1509 bases(100 bases per row)
ACTTGACGTGTAACACCGTTACACCATCCCCCCGTTAAGATTCGACGTATCGGTCCCGATACGTCAATCGACAGAACTTGACCAGACCGTCAAGTCCCAG
AGAGAACACCCGAGTTCATTCTAAGATGACCTCGCCACCGCCAACGTCCTCGTCCGCAGCCGCGGACGCGCAAGCCTTTCCTGCCGCAGAGGCGGCAGGA
AAGCAGAGGCGGCAGGAGCAACAGCGGCAGTGCCTGCTAGCACTGCTGCTTCCAGCCATGCGAGAGAGGGTAACCTCTCTCTCGGTCAATACTATGCTCT
CCAGAAGGAGAAGCATGCAGCGAAGCTCAGCTACGCTGTCGACCCCAAAGAGCTCTTCGGGGACGAGGAGGATCTCATCGATTATGAGGAAGATCCTGAA
GAGGGCGAGCTTGAAGACAAAGCTCCTGCCCTTGTGTCTTCTTTTGAAGACACGCATGACCCACCCTTGGGGTCTCGACGTCCCCGTGAAGAGGCTCCGG
ACGCTTCCAGTTCGAAGCGTCCACGTAGCGACGATGAAGCGTCCCCGATATCGAGGGCGCTCATCTCTCCGCGCACTGATCCTCCGCCAGTGCGCGCACC
CTGGATGCCTTCCGAGGCTGAGATCCAGGAGCGGTTCGGTGCTACTTGCCCACCAAACCCGATCCTGTTGTATCACGACAACAGGATCATTGACGACAAA
GTCGCCAAGAACACGGTCTTTGAGTCCCCAACTCAAAGACGCGACTACTACATCGGACTCTTCCATGAGCTCCGATACTTCAGCGCGAAGAAGACTTCGC
GCAAGAGCAAAGTACCAGAGTGGGAGGCACTTTGTCAGTCGTGGAACGCCTTTGTTGATAACTTCAACACGGCTCCGAAAGCCTATCCCGAGCTTGTTGA
CAATGCTCGCGAACGCTACTACACCTACACCGTTCGCGGTAGGTGTGAACGCCTCCATGGCCTATGCATGGAAGCGGGAATTCCCTGCACTGTGCCCTTT
GGCACGAGCTGCCCGTGCTGCCTGCCGATGGCAGCACGCCTCTCCGAAAGTGATCTTACGGGTTACACGTCGGTGCGTGTACCCGATCACATCAAGGAGC
TCCGTACTCGTATTGAGCCACGCGAAGCTCCGAGTGCTGTGGCTGACCGCAGCACTCCTCGTGCAGGGCTTAACCCTGCAAGTTATGGCGGGCTTCGTAC
GCCCTCACAATTTCCGGAACGTCCTCCATTAGGGCGTTCCGTGGTTCCGATGAATCTCGATGGGAAGGAAATCCTCTCCAACGAATTCGAAAACGACGAC
TTTGATGGGTCGTCGTCGTATGATCCACGATCGGCTCAACTATCCAGCGGATCGCTCCTCTCGCGTCGCGCAACGGCCGCGTAGGGGGTGGGAACACTCC
CTGCGTATGGTCAACGCTATGACCTTCACGATCGTGCCCTGCACGATCGGGTTGCTGCTCTTGAGCACTCCCAGAGCGCTGAGATAGCGTCTCTGCGTCA
AGAGGTGAG