Description :
From Genome Similarity Track
Location :
Scaffold_4:1129984- 1132300
Sequence
2316 bases(100 bases per row)
AGCTCCCGGCGGACCGAGGCGTGCGCCACGAGATCGACCTCGCGCCTGGGACGAAGTACTGTGTGACGCGGCAGTGGCCACTTCCACGTGACCAGGTGAA
GGCCATCGACGACTTCTTCGAGAGCCGCCGCTGGGCAGGTCACGTGCGCGAAAACATCTCGCCACACTCCAGCCCGACCTTTTGCGTCAAGAAGGCAACG
GGCGGGTGGCGCATTGTTCACGCGTGCAATAAGTTGAACGATGCCACCATACCCGCGCAGACGCCAATCCCGCGCAAGGACATAGTGCTGGACTCTATGG
CGGGAAGCGTGATCTACAGCGCCATCGATCTGACCGATGGGTTCTACCAGATACTCATGCGAGAGTGTGACAAACCTCTCACAGCGGTAAGCACTCCGAG
CGGCATGCTCTGGGAGTGGCTGGCGATGCCCCAAGGTCTGAAGAACGCGCCGGCCACGTTTAACCGCATGGTCTCCCATGTGATGTGCCCGCTCCGTGAC
TTCGCACCGAGCTACTTCGATGATATCTTCGTGCACAGTCGCGCCGAAGGTGACCTCAGCGCTGTCGAAGTCCACCTGAAGCACCTGAGGCAAGCCTTCC
AGGTGATGAGGGAGAACAAGCTCTACGCCAACTTGAAGAAGTGCGTGTTCTGCGCACCGGAGATCCCGGTGTTGGGCTGCTACGTGAGCAAGGACGGAGT
CCGCGCCGACCCTGAGAAGGTTGACTTGGCCGACCCCCACGAGTCCCACTGAGCTTCGTCAGTGGCTGGGCATGACGAACTACTTGCACAAGTACACCAA
GGACTACGCGAAGTTAATCCAGCCACTGCCGTCGCTGCTGAAGAAGGACACCACGTGGTCGTGGCGAGAAGAGCACCAAGCCGCATTTGACTCGGTGAAG
AGGAGTCTGTCATCCGCCCCTGTTTTGGTGCTCGCGGACAACTCGAAGCCATTCCACGTCGTCTGCGACGCGAGCGACTTTGCCATCGGGTACGCCCTGA
TGCAGTTCGACGACGAGGATCGTGAGCGGGTGATCAGCTACCAGTCCCGCCAGCTCAAGCCGGCGGAGAGGAACTACCCAGTCCACGACAAGGAGCTCCT
CGCCATGCGCCACGCATTGATCAAGTTCAGGGTCTACCTGTTCGGAGAGCAGACGTTTGCGGTCTACACCGACCATGCATCGCTGCGGACTGCGATGAAA
TCCCCGCATCTGTCCCAGCGCATGGCCCGCTGGCTGTCTTTCTTCTCCGAGTACAACTTCGTGGTGCGCTACAAGCCTGGCAAGAACAATATCCTCGTCG
ACGCGCTGTCTCGGCGTCCAGACTACGACCCACGTGAAGGCCTCGAGCGCCAGGCAGCTGACGAAGATGATGAAGACGCGTGTGCGACGTGTGTGATGTC
GGGGTTGAACCTGACGAGCGTCGCCCCCAAGATGCCGCTTCGGGACGGGATCGCCGCAGCGTACGAGCATGACGCGCAGTACACCAGCATCCTGGCCCAC
CTCCGCTCTCCAAGCGAGGCGACATTGAAGGCTCTGTCGCGCTCGACCCGCAGCCACGTCGAGCGATATCGGCTTGATGGCTCCCTGCTGACGTACACCA
TCGACCGATTCGATGCCCCGAGAGTGGTGGTGCCGAATGACGAAGACCTTCGCGCCCGGGTCATCCATGAGTACCACGATGCTCCGATCGGGGGTCACTT
GGGACGCGAAAAGACCTTCGCGACGGTGGCGCGAGACTTCTTCTGGCCCCACTTGTACAAGTGGGTGCGCAAGTGGGTGCGCACTTGCGAGATCTGCCAG
CGAGTAAAGCCCTCGCCGTCGTCACATGCTCCGCTGCGTCCCCTTCCGGTCCCCACGGAGGCCTGGCGCCCCGTCTCGATGGACTTCGTCTTCGGTCTTC
CACCCGACTCGAACGGGCGCCCGGGAGTCCTCGTTTTCGTCGACAGGTTCAGCAAGATGGTGCATCTCGTTCCAGTGGCTGCCACGGTTACTGCGGAAGA
GTCCGCAGACCACTTTGTCGACGCCGTCTTCCGCCTTCATGGTCTGCCCGATTCCATCGTCTCGGATCGGGATCCGAGGTTCACGTCCGCGTTTTGGACG
GAGCTGTTCAAGTTGCTTGGAACGAAGCTGGCGATGTCCACCGCGGCTCACCCGGAGACGGATGGACAAACCGAACGCGTCAACCGCGTCGTCGAAGACG
TGCTCCGCAGCTACGCTACGTCATTCCCGAGCTGGAGCGCTTTCCTGCCCCTGACCGAGTTCGCTCTGAACAACGCCGATCACTCGTCGACGGGCATGAC
TCCGTTCTTCGTGAAC