Description :
From Genome Similarity Track
Location :
Scaffold_84:112998- 115126
Transcript NameFunction/comments
Phyci_234923Hypothetical protein
Phyci_234803ABC transporter lipid export ABCA family

Sequence
2128 bases(100 bases per row)
TTACAGGCTCCAGAGCATGGTGGAGACAACACCCAGGCAGGCAGCGAGGCTGGCAGCCATGAGCTGTGACGATCCGCTGTCGGCGGTCTTGGCGCTAGAC
GCCGTGTCGCCACCCGAGGATTTGGTGGCGTCCGAGGTGCCGGTGGTGCCAGTGGTGCCAGTAGTACCAGTCGTGGTCGACGTGTCGCCGCCGGGGGAGA
CGGTGCCCACAGCCTCGCTGGACGAGCCGGAGGTCGTGGTGGAGCTGCCCGAGGAGGTTGAGTAGTCGCCCGTCTTGGTGAACTTGAGGTTCGAGTACGC
CGTCTTCATGGTTCCCGTCTCGTCGAAGATGCCGAAGTGCGATTCGACCGTGGTGGCGTCGTCCTCCTGCTTCTCCTTGTAGGGCGTGTCGAAGCCCGCG
AAGTAGTAGTACTTCCACTTCTTGGCCTCCGCTAGCTCATAAAAGTCGTTCAGGTACGTGGCGCCGTTCTCTTCCGAGGCCACAGAGCCGTTGGTGGCCG
TGCCGGCCGTGGGCCAGCCCGTCTCGCTGATGATGACCTCCATGTCGCCGGCCATCTTGATCAGCGGCTGGATGCGCTTGTTGAACTGCGCGGCGGCCTT
GTTGGCCTCGATCTTCTCCCAGAACGGGAATTGGTTGATGGTCACGATGTCGCCGGCCTTGAGCATGTCCGGGTACTGCACGAACGTGTCGATGATGTCG
GTGATGCTGACCGGGACGCTGATTTTGTTGTCCGACATGACCTTCTTGAAGTCGGTCACGTACTCGATGGCCTGCTCGGCCGTGATGTCCTTACGGTAGA
CGGCTTCGCTGCCGACGTTGATGCCCACGACGTTGCTGTCGATAAGGCCGGCGCTGATGAGCTTCTTGAAGGCTGTGACCTCGGCGTCGTAGACCTTGGA
GTCGTCGGACACCCAGACGCCGAGCCACACGGTGAGCGACAGCTTCTTGGCGGCCGTGAGCACGCCCGAGACGTCGCAGTCCGACAGACTGTACGTGCGC
ACGTTGGACGTGATGGTGCTCAGGACCTTGAGGTCGGACGCGATGGTGTCGGCGGACTTGCACCTGCTCGGGTCCCAGTCGGGGCCCTGGCGCAGGTCGT
AGTTGACGCCGTAGAGCTTCTGGTCCAGCGCGGCGGTCGAGGACGCCAGCACGGCCACGGCGGCGGCGGCGGAGAGCGAGACCACGCGAACCATCTTGGA
CTAGTCGGGTGGGAGGGGGGAGGGGCTGAGTTGTACCGCTTGCTCGACTGCTGGACGAGCGCAAATCGGTGAGTGAGGCGGCGAACAGCGAACAGACTGT
ACTATAGAGAGAGACAGCGCCTGATTCTTATGTGCTCGCACACACACAGGCGGTTCGTGGGAAGTTCTCCGCCAATGGGCGTCGCCTGAGTTATCGTCCT
CTTGAGATGGTAACGGGTGCACTTCGCAACGCCATACTTGTACTTATACGACCGTAGTGATGAACTGCCATCGAGCGAGTGTGTATGTACGTGCATGTAT
GGAGGCGATGCAATACATGTAACTGTGGATTAAAATGTGTTAGCGCTGTCCGCGGGGTCGGAAGTTTGTCCATTGCGATTCGCTGCGGTAATGGCGATCG
GGCGTGCACGAGGCGCAGAGTGCGGACAGCATGAGGCTTTTACTGTTTGAACGCTGTGTTGCGCTGCGACTCGACGAGAATCCAAGGGTGGCGGTGCAGA
GAACACCTCGGTCATAGCGTCGAGGCGCGGAGGAATTGGGTGGTCGTGCTGTGGCACTCCGGACTCTGGTGCGGAGATCACCTCTGATGCAGAGGTTCGA
GGTGACCTCACGCCTGCATCACGATCATTTGAGACTCACCCGTAGGTCTGCGTTGAGTTCGCACCACCGTTATCGGAGTTTCGTGAATCCGCGCCGTTGC
GctgccgagcgaacgagttgaagatctgctccagacttgtctgcgacaggctgtactccttgatgCCCAGCCGGCCCCTGGCGTCTTCCACCAGGCCAAA
CATGCGCGACAGTGCAGTGGCTACTTGTGGAGCTGTGTCGCTCTCTGCCTCGGTTTTCGTTTCGGGGGAAATGTCCGAGACCTTGTAGCGGCAGAAATCG
GCTTGCCGCTCCAACAGCGTCACGCCAC