Description :
From Genome Similarity Track
Location :
Scaffold_96:112998- 114250
Transcript NameFunction/comments
Phyra_83785cysteine protease family C01A, putative

Sequence
1252 bases(100 bases per row)
CACCAATCTCCGCTCGACCCATGCACGCAGGCATCGACTACGAGCGCTATCTTGCCGAGAAAGAAGTCACCCATGTGGAGTGGAGAAATTGGCTCGAGAA
GCACGGCTCTGATGCCGAAAAGCGAGGACTAATGCCCACTTCCGAGGACCGCAGCATGGACGACTTCGAGGAGGACGCGCGCCAGCGGATCTTCATGAGC
AAAGATGACGTCGCAAAGGCCCAAGCTGCCAACCCGGACGCCAACTTCTCCATCGACGTGGTCTACTCCATCCTCACGAAGGAGGAGTTCGCCTCCAAGA
TCCTCAACTCGTACGCGAAGGGCAACGGAGCGATCACCCGCCTGCCTTCTCGCTCTCGCTCACTCCGCACGCAATACGACTTCACGAGCAGTATTGAGTC
TCCTGTGCAAGAAGACACGCGTGGAGATAGTATCGCTGCAGCGAAAAGGCCAGCCACCGCCATGTCTTACACCTCGGCCACGCGGAGACCCGCTTTCGTG
CGCCACGGAACCTCAGCTACTACGCCTTGTGCGAAGGAGAAGTCCAAGAAGCAGAAGTTGGTGCCGACGACGAAAGCTCCTACTAGAAAGGTCTCGACCA
AAAGGCCCTACACTATCCATACCACAAAGGCTCCTATCAAGAAGACCCCGGCAACCACCAAAGCAGCAACCGCAACCAAGAGGAGCTCCGTCGACTGGAC
CAAGTCGCCGTGCATCTCGCCGGTCCAGAACCAGGGTCAGTGCGGAGACTGCTGGGCCTTTGCCTCAGCCTCAGTGGTCGAGTCTGCGCAGTGCATCGCC
GGCGGACAGAAGTCGCTGAACAAGTTCTCGGAGCAGCAACTCGTGAGCTGCAACACGCAGAACTACGGCTGCAACGGCGGGGCCCCGCAGTACGCCTTTG
ACTATATTATGAAGAACGGCTTTTGCATGGAGGCCTCATACAAGTACACGTCTGGCGAGGGTAGCGTTCCACGATGCTATAGCTGCACCAAGACCACACC
GGGTATCAAGGGCTACAATGTGCTGGACGTAGGCGACGAGGCCGGACTCATCAAGGCCATCAACCAGCGCCCGACGGTCGTGACGGTGGCCGCCGGCAAC
GAAGCGTGGAAGCAGTACACTGGCGGCGTGCTCTCGAGCTGTGACACCACTGACCTCGATCACCTCGTGGTGGCGGTGGGCTACGACGCGACGAGTCTCA
AGATCCGCAACTCGTGGGGCGAGAACTGGGGCGAGGAAGGCTACATCCACTT