Description :
From Genome Similarity Track
Location :
Scaffold_182:11299- 14847
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_182-fgenesh-gene-0.12AP-4 complex subunit epsilon

Sequence
3548 bases(100 bases per row)
TGCTGTGGGTTCATGGGCACCGAGTTGAGCAAGCATGCGATCCACGGGATCACGAAGCGGCGATCGCGAAATGTTTAGTAAGGCTAAaGTGTCAGCCACA
TAGATTCACGCGGGGGAGCGAACACACAAAATGCCTGTATTCGACCTGCCACTCCACACCGTACAGTATATCTCTACGCTACGTGCATTCGCCGCCGTCC
TGATATTGGGTATGGGCTCTCGGCGGGTCGGAATGCGTCTACGATAGGCCATGTGCTGTCCTTCGCACACAGCAGAGTGTGTGCTCGCTTACTTAaGACG
TTGAGCGATTGCATCGATGAGCTGGTCTGTGAAACCCATGTCAGCGGTTCGCACCGTCAGGTCCAAGAAGCCACCACTACGGATCTTGACGTGGATGAGC
GCCACATGCTCCGAGTTGGCtAGACGCGCGGCGGCAATGGCCTCATTAGCTGCAAGGGAAAAACGCGTGAGTCCTTTGTGCTGTACAGATGGACAGAGAG
AAGCAGTTACaTACTGGCTGGAATTGCCTCGACCGTGTGGACAGCGAACTGGTACATGCGACCTGAAAAGTCATCCAGCGTTCGCACTGAGCTCGGGTTG
ACCTTGGTCTTCTTTtCGCATGGGCAcGTTCCCCATCGCGCaCCAAAGTCCTGAGTCGTGATCTGCCACAGCTCAAGCGCTCGGCCGTTGTATTGGAAAC
CGGCTGATTGTGTTCGAGAAATGTCtGTAAGAAAaCCAATAGCGAATTAGTATACCAATAGGTGGAGCCTTTCAAGCGTGTTGCATACCGTTGACACTGG
CCGTGAGACCGCTGAGATTGAATGGGTCCAGCATGGCGGATGGcgCTGGAGCAGGAGGGgCTGCAACAGGGgCTGGGGCACCGAGACCAAACGGATCCAC
CCCGAGTGGCTGTGgCTGGTAAGGAGCTGGTGCGTGCTGTGTTGGTGCTGGGGCAGGAGCGTCAAAGATATCAAGCAGGTCGACTTCAACACTCGGCTGT
GGTGGaGgTGGCTGGTTATACTGCTGAGGTTGAGGTGCCGCATCCTGACGGGCGGAGGTGCGACGAAGAGATGATCGAGCTCCGCTTGTTCGACGAGTTG
TGCCACCTGTGAGTGAAGTGCGGGGCCCACTAGTCTGTCGTCGGGGCATTGGAgCCGGGGCACCAGGGATACCACCGAAGATTGCTGAGGCCATCATTTG
GCGCTCGTCGACCTGGTCATCACCGTTTTCTTCTTCATGAACAGACTCGGTTGAGTATGAAgaTGGCTGGTTGTAGTCTGGCTGACCGCCATAACCTCCG
TAAGGAGCAGCAGGAGCTGGAGGTGGGGCACCTGGGTACTGCTGGCCATACACACCACCGTTTGGAGCAACAGGAgAAGGCTGCGgTTCGTTGCCAGTGT
TCAGACCAGTCGGGCCCCAAACgTTCTTCGGCTTAGCGGCGTTGTAACCCGTCGTAGGGCCTGCACCACCCTGCCAGGCTCCGCCTGCTGGGGCACCAGG
GTTGGCACCGTAGGGCTGAgCGGGCTGCTGAGGAGCACCCCACTTGTTCATGAATGGGCCAGACGTGTCGTTTGGAGGAAGCTTGACAGCGTATGGAATC
TCAGGCTTTTGGtAAGCCTCAAAGTTCAGTCGGTTACCATCCTTGCCCTTGTGATCGTAGTTGTCTTCGTCGTCAGACTCCTCTGGTGGATCGTACAGTG
GAGCACCGTTGTTGACAGCGCGCTGCACAAAAGCAGTGAGGAAGCCAAGATTAGGATCGACCTCGAGATCCTCACAGCTGGCATCTTCAGGGTACACCTC
AGCCATAAGGCTCAGGTTCTTCACCATCGCCAAGTACTCAAAGCAGCGCTGCTGAAGATCTGTGCTTCGGCTCGACTTGTACTTGTGCATCATAGCATTG
GCAACGTCGCTTGTGTGTCCCATTTGTGCCGTGATCTTGGTCACAGCAGTAATAATGTAACCACGGGTAACATCCTCCTGGTTGAATGGACGGTCAATCA
GCTCACACAGACGCTCACAGATTTCTTCGAGTTCCATCACTTCAGACAGGTAACCGTACTCGCCAAGCACCCAAGACATCGTGCACACGAGAATGTCGGA
CAAGACTGGGCGTTCAAAAAGCTCGAGATAAGTGTCGACAGCATCACGGCGTAGCTCCATGTCCTGaTCCTCATCTTCACCACTGCCTTCAGCAATCAAT
CGAAGCAAGTTGTGTGCAACCTCAGGTCGGACGAGATCACCACCGAGCTCAAACACGTTGGTCATCGTCTGGATGTACCACGCATTACTAGGGGCGTATC
GCTCGGCACACTGCGTGATTCGAGACACGAGTTCTGTTCGCAAGAAGACATCCGTAGCTTCACGAAGGAACTGaGTGAGCTTTTCTGAGATAAACTCCAC
ATTCACTGGGTTCGTCATGCGGTACAGCAGGTCCAACGTCTTTCGCTTGAGAGTCTCATCTGGATCTTCCAAGCAATCAATCACTGCCATCTGATGAGCC
GCGGCGTAACGTGGGTGGTCCTTCACAATCGCTGCAAGACCCGTGACACCAAGGTACTTGAGGTTGTGGTTGTCACTGCTGATGAAGCGGGAGATACTTG
CCGCAGCAGCATCGAGGAGCGTGCTGTTCGGGTAAATCGTCGTGACCGTGCGCACGCACTCATAGATGATCGCGTAGCCGACATTAATACCGGTATCCGC
ACGACGCATGACGTCATGCAGCACTTCGTACATACCCTCACTGGTTTGCTGGTCCGCCTGACCGAGCAACGCCAAGATCTTGAGCAAGCGGATCTGAATC
CACGGCGCCGGAATGCGGTGGTAGTCGAACTCACGCGGCAGACGGTGTTCAGTGATCTGCTTGAGGATACTTACGAAGCTGGGTACGAGGTCCTTGTAGT
CGGTCGGGTTCACAAGCGCCAAGTCGTGAAGGCTGCAGAGCGAAGCGCCCATGACACTCGGGTCACGGTCGCATAATGCACGGCGCAGGGCATCGCCCGA
GTCGCGCACGGAGTCtGGgTTGAGCTGGTGGAAGCGGTGCACCGCCATCACGGCCTTCTTACGCACAAGCTCCGCGTCGTGACGGAGCAGGTCCATAATG
AGCGGCTGTACGGCGGGGATCATCTCGACCGTGACAAGCTTGCACACGGCCGTGAGCGCGGCACAGACTTCCAAATGGTTGGACGACTGCAAGTCGCGCT
GCAACtGGTTGATGATCATGAAGCGGAACTCGTGcGTGGGCGAGAGCACGAGCGAGCACGTCAAGTAGCCCACGCGCTTTTGGATGAGGTTGGTCGAGGC
CGTCATTTCCACGGCCTTGATGTAGCCGAACGATGCGTCATGCCCCAGCATCTCGACGTACATGAGGCGGATCAGGAACTCTTTCTTCTTCTTGTTCACT
TCCTTGCCCGAGCTCGACGTCGTGGTCGTCACTTCGCTCATCTTGCGCTTGAGCTGCGCGACCTCATGGATGATGATGCGGTCTTCCTCCTGCTTCGACT
TGCTCTCGCCGATGGACTTGACGAGTTCAAAGAACTCCTTGGACAGGT