Description :
From Genome Similarity Track
Location :
Scaffold_422:11298- 15041
Transcript NameFunction/comments
Hyaar_Emoy2814108hypothetical protein
Hyaar_Emoy2814109hypothetical protein

Sequence
3743 bases(100 bases per row)
AAGCAGTGGTCCGTTTCGTGCAAGACTCCATCGCTAACGCGGTGGACCGGCAGAAACGGAACACTGACAAACATGGAAGAGCAAACGATCTTCTATTTAA
TGTTGGAGACCTTGTTCTAATGTCTACGGTAAATCTAGCTAAGCACGTAGAAACTAATGTGGGTAGTAGTAAACTACAACCCAAGTATATTGGCCCGTTT
CGTGTACTACATCGCAAAGGCAATGCGTACACAACCGAGTTGCCCCGTAGGATGCGTACGAATACTACGCTTTATGTCGGTCGTCTCCACCCGTACCATC
ACCACGAAGTCTCTTCCTCGGGCAAATACAACCACCACGTTCAAGAACCTCCAAGAGATTCCTTTGGTCGCGAGCCAGCTTCTCAATCTGGCTCTGTAGA
TAAACATTCTGGCGACGAAGGTCAGCCACTTCGTCGCGAAAGACTTGACGACCCCGCTCTTTTTCCAATTGGGAGAACGCGATCTTCGATCGGTCGTCCG
ATCGATAAAGGCGGATGCGTTGCACCCACGCCTCCAAAGAGATACGCTCCTGCCTCTCTTGTTCGGTGCGATCACACAGATCGTGTAAACGTTGCTGGAG
ACGACCAACCTCCGCCTGCACCTCCGAGAGATTCGGAGTTGATATTCCCGCCCCTACCACAGCCATTGGTGGATTCGCACGGTGGTCAATGGTTTTACGT
GGAGCGTATCTTGAATCACCGTGACGTGAAGGGGCAGCGAGCGAGTTATCTTGTTCGCTGGCGCGGCTATCCGCCGTCGCACGACAGCTGAGCGCGAGGC
ACCCAGCTGATGATTTACGTTGAGGGTCTCGTACACCAGCACGACGAGACACATCCGATGCCTCAGCAGTACCATCGGAAAACACGCGCCCATGGCGCTG
GTAGAGTGATTGCAGATTAGCAATCTCATCGCTCATCTCAGAAGAGATGTGCGCCCTACCCCAGGGCGAAGAAAGAGAGTTCACCGCCCTGCTGATTCGT
TGAGTGTTGTCGAAACAACACGGACACGGGTCGCTCCACGTGGGACATGAAATTCCTGCCTCACGAGACAGCTTGTGCAATTTGACTTTTGCACCAGTCA
AGGGTGGTTTCTCAAACCTGACACAAGCTGTGTCAAGCTTCCGAAGCCAATCTTCGCGCCCAACATGCTGCACATTGAGTATAAAGGTATTCCACACGTG
CAGCAACGAACTTTTGTCTCGTTTAGTGTTGCCACTATACCAACCATGCTTCAGAAAAGCATCCAGATAGAAGTCCTCTTCAGCGCGAAAGTTACTAGCG
CTGTTGTCGAGTCCGTGGATCTGTCTCGCATCGAATATTAGAATTCGATAATGAAGACTTGTCTCGCCTGACAAGTCATTCAAAAGCCTTTCTGGTAACA
CCCAAGGCTTGTGTTCAGGGGCTGGACGCAGTACATTGCCGTCTAGAGCCTCCTGCGTGGTACCAACGGAAGCCTTGGTACCACCAGAATCGTCATCACG
ACGGTTCAAGCCATCACCGCATTCGCTATAAGGCGAATGCGCAGTAGCGCGCGCGAGGGATGAGTCAGCATGCTCAGTCTGCCACTATAGACTCGGGTGA
CCTAGATGTCTTCTTCGAGCCGGACCCACCTTCCGACTCCCCCGAGTAGATAAGCTCCACTTGAGATCCATCATCGTTAGCATGTGGTGACTCACCACGT
TTATCTGCAGAAACTGGTGCTGCAGGAAGAGTTGAAGCGGCAACAGACGAAGTATCGTCTGCCGCGAGAGGCTGGGCATCGTCAAGATCAGCTGCGTTAA
CACGCGCAGCTGCCTTCTCGGCAGTTTTCGCCGCGCATTGCATGGAGTTGTTCACCATGCGATGACAATCCAGAAATGGATGGATCAGACCAAAACAAGT
GCTCCCTGTCCCTGATGTGGTCTAACGGTGACCACATCAACATGATAGTGATTGAGTGACTATCGTTTAACGAGGGGGTGATGTAACGGGGTGAGCCTGT
TACATGTAATCAACCCTTGATACTTGCTAATTAGAATATTATCATAAAGGTTGATAATGCTCGTGAATGTTACCATAAGGGGTAATATTCAGAACACTCA
CCGATTGGCTGATATGAGTGACTATATCAGCCAGCTCTAGCGGTCCAATCAACGATCGACGCGCGCAATGAGTGGTGAGCAAGACTTTAGCACACATTTT
TGTGGATAAATATAATCAAGACAGGACTAAGACATAGGTTAATGATTAGGACTTAATTATATTTACTACAGTTTTACTTTTACCAACAACTAGACTGTCT
CTAGTTGTTTACCTTCCTCTGCACGTTTGCTAGAAGTAGCGAGGCACCACTAGCACTGCTGTCGGTGATAGCAGCTCCACACTGGTTGTCCAGTGTGTTG
CTCCGGTGCCCTGTTACACACACACAAAGATAAGTACTATTTAAAAAGTTCGACATTCACCATGCAACAGTCACTAATTGTTTCACCCTTTGGGCTCGTA
TCACATACGTTCAATCCTCGGATAACTCATAGGATTGGGGGAGACAAATTCCATGAATTAGCCGAGTTATGTGTTACGTGTATTTCCGGTTATCTTTTTG
TGGAAAGTACAGTAAATTAGCAGTGCCCCTTCTAAATTTCATATAAACATGTCCCAAGTACTGTCACTAAAGCACAAAGGCTCGTGATTTGCCAGCACAA
GGCCAAGAATATAAAAATGAGCCGGAGTGTTTTGACAAATTGGGCTTCCGGCAAGTTTGTATTTTAGATCACACAGAACGATATTTATCTCATAATCAAG
AAGCGCACTGATCTAAAATCAATGACAGATTACGATCATTCAGCCAAAAGCCCGAGAGGTGCTTAAAAGCCAAAGCTGAATGAAGGCCTGTCAAACTGGG
CGCTTCAATGCCAAACAAGGAAGGTTTTTCTGATTGGAGAAATTATTTAGATCAAGGTCAGGTAAAAAGCTGCACAGCATCAGGATTTGTTGCAGTAAGA
GGAGTTCAGCAAATGAGAATGCCACGGATGCAACATTGCCTTGACTTTGGGCTGTAATTGGTCGCCATGAGCCCCAAGATGTTTTCAACATGAACAAAAG
TTGCGTGAGGATCAAGAAATATTTATTTAGGCTGATGGTGTACAATACTGAAACTGATTTAGGCGTATTTACAACATGATTAAGAGAAGACAGCTCAATA
GAAAGTGATTGAGGGTCTCAAGAAATAGAAGTCAGAACTGAATTGATTATTAGAAAAAAATTAAGGTTGCATTTTGCAGCTCAAAAGCAGTTCACTTCCT
TTTTTATTCAGGTACGGATCTCTATTGCCTTCACGGTCAATGCGGGTGATACTTCAGATGTCCATCCGTGTGGCTGCTACAACTCAGAGCACCCTAAGTT
CTTGTATTTACTAATTTAGTACACTCAGACACTTAGTCCCCCTTCGATTGTGCATTTTTATATAGGAATATGATTTCCTTAGTTCAGGAGTATACAAAAA
TTTATAATCGTATGAATTGTTGTCCCACAAAAAAACTCATAAATTTCCGATAGTAATGAGTTATGAGTTGGCGACCATAGAACGAGCAAGTTGGAACGCA
ATTTGTAAGATAGGGGAGCAAGCTCTAGAGCTCGTCCTTTGATAAAAGTAATCCAGCTCAGAGAACTGAATCAAGTTGCAAAACACTATACAGCAGCAGT
CACTGAACAAGGGGTATGATGCTGTAAATGTCTGTATTAAACC