Description :
From Genome Similarity Track
Location :
Scaffold_833:11290- 12969
Transcript NameFunction/comments
Phypl_g11207hypothetical protein PHYSODRAFT_342937

Sequence
1679 bases(100 bases per row)
CCACTTTCTCCGAACTGAAGGAATTTCACGGACGAGATACCAGTGAAGAGAAGTCCAAAGCCTGACCGAATCGCGTGAAATCAGCATCACGCCGCGACGG
TATGACCGGGATGGAAGTGCGCGCCTCGTTCGGAGACGTGATGACCGGACCAGAACGTCAATGATACTTGCACCTGACCAAAAAGATCAGGAAGTCATGG
CCGGACCTGATGAAACAATTCCCCACTCAGAACTGCGGCAAGAGTGTATCCATGGCAACCCGGTACTACCATGTATCCAAGCACACCGACGAGACTCCCC
TGGATTACTTGCATCGACTCAATGGCGCGTGAATGCGAACCAAGATCCGGTACGCGGACGGCACGGCAGAAGAGAAACGGGAGCACGTGGAGTTGTTCAC
CAATGCCCTAGGAGtgcaagagcaagagctggCGTCTCGGCTTACCCTGATGGAAGTTCTCGACACCGCTACGCTCGAAAAGAAGCTGCGTTCCCGGCAG
CGTGGACTGGATCAACACAAGAAGTCCTTGTTCGGGTCGAACAAGTTCCGACAGAAGTACCAAATTCAGCGCAACTGACACGCACAGAACACGCCATCCA
GGTCGCACCGGAGGGTACGACTCGGGACGTGAAATTCGTGGTAGTGACCAGGATTGGGATGATGATGAACGAGCCAGATTGTTCGTAGCAGGCCAGGCGC
AGGCTGGCGAGGGCACGCGCCGCAACCCAGACGCCGAAGACTCGGGACGCGATCGACCACGGTGCCGCCATTGTAGCTCTTGCCGCCACGGTGACGGAGA
CTGCTGGAGCCTACTGATGTGCCAGCAGTGTACTGGCAACCATCCCTCGGACCGAAGCCTACGCGCGTGCAAGGCCTGCGGAGACGTGCACGAAGCAGTC
CCTTGGAGGTGTCCTTCCTTTGGAAGAGTTCTACAACCAGCTTCGCCAGTGGTACAATCCACATATGCATGCGGGAATGTTGCCGCCGTCAGCTGAAAAG
ATGTTAAACTAGATCGCTCGCTAGGATGGAACTCAGTACTAGACGAGCGATTTGTTTTCGTTTATGCAGATGTGGCCAACACGTCGCAAGAGGTGGTTCA
TGCAGACTCGACTACCCCGAGTGATAATACATGTGAATCCAACCTGGAACGTACCTCGCGGCGACACCCTCCCGAGTCACTACCCCCCGACACGGAGACG
AGTATGCGCGCGAGCCACCGCTGGGTGTGGTTGACCTGCAACCGAGAGAACGGCGTGGATACCGGAAAATATACGCGTCGGACAAATGGTACCAGCAGGC
CAATATTCACGGGAAGCCGAACAACCACCGAGCTGTATTGTTGCTCGACACAGGTGCCGAGGTGTCTATAATGGATACCGCCTTCGCTCGTGAGGCAGGC
TGCCTGATCGACACGGACATAATACAAGAGTGCGTGAGAATCAGAGATGATACGTACTACACGGTGGGGAGAACGAGAGTCAAGATCACCTTAGCCGGGA
ACTGGGTCTACTTCCTGGATCTCTGGGTCGGCGACTTGGTGGGGCAGCACACGATCTTGCGAACGAATTTTAAGGTGCCCGCCGGAGTACGGATCGATAC
AGCCGACGGTACAGTGTGTTTGTCTGACGAGCTGCGGGTACAGTTGATTGGAAGGAGGACGCTGTACGGCGCGAAGATG