Description :
From Genome Similarity Track
Location :
Scaffold_1581:1129- 3806
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1581-snap-gene-0.6Inositol polyphosphate multikinase
Pytiw_DAOMBR242034maker-piw_contig_1581-snap-gene-0.3Dtdp-4-dehydrorhamnose dehydrogenase

Sequence
2677 bases(100 bases per row)
ACCTGCTTCAGGAGCTCCTGGAAGCACTGGATGGTCGTGGCGATGCCCTTGCAGACGCCATCGTCTCGCTGCAGGGCGTGCGACGGACGATGCGTCACGT
GCGCAAAGTCGATGAGGCGAATGTCGGGACTCAGCGCTCTCTCCAGGGTCACATCGTCCCCACAGGCGCCGCCCTCAACTGCGCCGTTGTAGAGGAACAG
GAGCGAGCTGGCGATGAACTCGAGCTCCTGCTGCTCGTCGAACCAGAGCTTGAACTGCTCCAGGCGCGATACAAACTAGCAATAACCGATAAATATTAGT
CCAGTCTACGCTAATAATGACCATGCGATATACAGACTCGTACCGCTCGGAGTAGCACAGCGACCGTGCCCTTGTCGTGCTCGTAGGTTGAAAAGAATTT
GCCGAACGCCGGCACGAGATCCTCTGGCGAGCGCACCTGGCGCCCAAAGTGCTTGTCGAACTCCACGTACTGCTCCTGCGCTGGTGCGAAGACCTTGATG
CCCTGGATGCGGAAGCCCACGGCCTCCTGGAGCGCGAACTTCTGCTTCTCGTAGGCGATTTTCTCGGCGCTGGCGTCCTGTTCGTATGACCGCGTGCCCA
CTTTGACGTCCATGATGCACGGCCACAGCCGGCCGTAGGTCAGGTCGTCCATCACCAAGTGTTCTACAGCCACACACACACACTGTCAGTATCAATGCCA
TAAATAACTAGCAGCCCCAATTCACGGCCACGTACTGCCATCGCGGCTTTCGCTGCCGGCATCCTCACTGGCGGCGCCCAGGTGATCGCCAGTGGGGACG
ACCACCATGCCATGATAACCGGGGATCAGCGACCGCAGCCGCTCCAAGGTCGGCTTTACGCCCTCGTCGCTGCGGAAGACCTGCTCGTAGAACTCGTGCT
CGCGCTCGCCGCGGCGCTTGTTCTGGAACGGCTTGAGGATCTTCCCGCCGAATGATTTCAAACCTGCAGATGTGTTTTGTTAATGAGGTTAGCGCTTCAC
ACAGACAATATGAGCATACGCGGACAGCAAAAGCACACGCAGACCTTACTGTTCTTTGCGGTCGCGTGGCCGCCCACTTGATGCGTCATTTCTTCGAAGC
GCGCGACGTCGGCCACCACGAGCGCGTCGCCATCTTGATCCGCCATGATTGTGTGTATTTGTCCAATTTTGAACGAGCTTCCACAATTGAATCAGACTCA
GGTGAGCAGCTCTTTCATTTATTGCATCAGATATACGAAACAAATCTGAGTCCGTATTTGAATAGCATTCATGACACGCGTGCTCGTGCTCGGCGGCTCC
AGCTACGTGGCGCAGTTCGTGCTGCAGCGGCACCTGCCGGCACAGTTCGATGCAGTCAGTGGTGGCAGCACACAGACGACCTTCGTGATGGCGTGCACCA
TGCGCGGGGACCCATCGTTCTCCGCCCAGCTCCCCCATGGGTTTGAGGGCGTAGCTCTCCACTCCCCACCGCCTACGAGCAGCTCACATGTCTACGTGTA
CTGGGAAGTGGACCTTGGCACCATGCAGGGCGTGCGTGAGAGCATTCACCACTTCCGCCCCAGTGTGGTCATCAACTGCGTCGGTGAGTAGTGAGCTCGT
TGCTCGTGGAGGATTACCGCGACTAACAGACTCGTTCTTCTATGTATGTGTGTGTGAATAGCGATGTCGTCACCCGCATCATGCGAGAAAGAGCCCGAGA
GAGCCAAGCTCATCAACGAGGTGCGGTCTCCACGATTGACGGCTATGTGCGCTCATGAATAACGATATAATGGGGCTATGCGTGTACAAACAGCCGAGAG
CCCTTATCGAGTTCCTCGCCCAAGAAGTCGACTGGAACGTGCACTTCCTGCATTTCTCCACAGTGCGTACATCAGTTGCTCGTGTATGTATTCACATGCC
CTTATATGTCAGCAGCTCACCTCTCTTCCCCGGATAGGATTTCGTGTACGACGGCGCGACTCCACCTGCAAATGGCTACAAAGAGAGCAACGCTGGATCG
CCAGCTCTCACAGTATACGGCGCCTCCAAGCTCGCTTTCGATGCTTTTCTCCTCGCTCAGCAGTCCGAGCATCTCAGTGGCGTCGTCCTCCGGATCGCGA
ATGTGATTGGCCCCCAGTCGCCGATTTTTGCCAACCAACCCGTGAAATTTATGGAGTGGCTGCACCAGGAGCTCTTTGGGGAAGTTGAGGGCAGCAAGGA
GACGGCCGCTCGCTCGCTGCGTATCTGGAGCGACGAGGTCCGCTCGTTTATCTACGTGCGCGACCTGGCAACGATAGTCTTTGCACTCTTGGAGAGCGAT
ACCACGGCATCACCTTCGCGATTCCTGCTTCTCAACATTGGTTCGTGTCTCGATGCCAACCTTTATATGTGGTAATGGATAGCTTGGACTGCAATGTTCT
AACCTATGCTGGTTTCTGTAGGCGGCATCGACACTCTCTCGCGAGTGGAGCTGGCTGAGCGCTACTTGGCAGCCTGTCAGCGCGTCGACTCGGAGAATCC
AATGCCACGCGCCGTCATCGCGCCGACCTCACGAGCAACCGTGGACTTGGGGTACCACCCGCCTCTGAATGCGCGTCTCGACACCGCAAAGCTGCACCAG
CAGCTTCCAGCGCTCGCGCTCACGCCGTCAGACAGGATCATGGAGGAGATCTGTCAAGAGCTGCTGCTGTTAAAGTG