Description :
From Genome Similarity Track
Location :
Scaffold_74:112884- 118436
Transcript NameFunction/comments
Phyci_94743Hypothetical protein
Phyci_526743myosinlike protein putative

Sequence
5552 bases(100 bases per row)
CCACTTTGTCTTTCGCAGTCTATCCCCCAAGTGCGTTGGCTATCCACCCACCCAGACAGACAGACATGGCGTCGGCAGAGAGCTTATGGCCGAGAACGAG
CGCATGGCACGCGAGATCCACGCGCTGCTGAGCGCCAACACGACGCTGCAGAAGGAGGTGCTGGCGCTCGGCTCAGAGCGCGACGAGCTTGAGGCCTCGG
GCAGCAGGAAGGTGCAGTCGCTGGCGCAGGAGCTCGAGAGCGTGGACGAGGAGCTGGCCTCCCTGCGCTCGCAGTGCCAGTCCATGACGGAGATCCTCGA
GCGCGCAGACGCCGACAACGAGGTGGACGAGAAGGACGAACCCGTGCCCGTGCCCGTCAGCCGCCGCCTCTCCACCGCCTTCAACCAGACCGTGCAGCGC
GCCAGGACCATGTCCATGCCTCGCCAGCGCCGCTCGTCCACCGTGGACAGGGTCGCGCACGGCCTCACCAAGGCCGCGAGCTACATCATTCCGCCCTCGG
ACAGACACAGCCCCGACGGCCCGCGCCGCCCCAGGATGAGCAAGGACAGCCCGCCCATCCTGTCCTACGGCAAGGGCTCGACGGACGCCACCAAGAGCCT
GCTCTTCTCCACGCACTCGCACTACGGCAACTTCCGCCGACACAGCGGGCCGTACCGAAAGACGCGCGAGCCAACCAGCGACCCGGTCGTCGTGATCTAA
CCGGTCTGCATTCGACCCGAAGCAAGCGTCGATCGACAGCCACAAGCTCCTGCATTACAATATTTAACGCCAACTACCATGTCCAGCCTATCCGTCCAGT
CTAGCGTCAACCGCTGTGGAGGACCCATTCGTCCAGACTACCACCACCCCGGACTTCGCTGCCCTCCGCTGCTTGCTCTTCCGACGGACAGAAGAGCAAC
GGGAGGGGAAGTACTAGTTGAAGTTGTTGAGGTGGTATATTACCATTGCCTGTCAGTCATTGTTCAATACAAGTGCGGCTCCATCCCGTGTGCCTGCCTC
ATACCCTGCCAATTCGTGAGCGTCGAAAGTCATTCTGTATCGGATTCTACTGCATCTGCCAGCAGAGCCTGCTGTGGCAGCGTACCATCATCAAGAGCAC
GAAGGATGTGTAGGTTGATATGTTTATTACCGGTATGAAAAATCCTAGCACGACTACTTGAGGGAAACACGCATATTCGAAGGGCTGGGGCGACAACACG
CTAAACTGCGGGTTCGTGGTGCCTCCCCGGCGCATCTTCGTCTACTTAAGGCGCGTTAGCCGACTTCTGGCGCGCCAGCTTCTGCGCCTTGAGCGAGGCC
AGCGTCGGGCGCTCGAACTGGGACTTGCCCAGCTTGCGGTTCACGTAGTACACGCGGCCAGTCGAGCGCGACACCTTGGCCTCCCAGCCCACGGGAAGAG
ATACTTCCGGCAACGCATCCAGGTTGAACGACTCGCGCACGGGGCGATCCACCGGCTTAGCCGCCGGCTTCACCTTTGCGGTCTTCGAGGTCACAACCGT
CGTCGACGCAACGTTGTCGGATGTGGTGGTGGTGGTCGTCGCCGCTTCCTCAGGCTTGCTGTTCGTGCGCTTGCTCCGGGAATCGTACATGCCCTTCACT
ACCGACATACGGCCCTTCAGAGTCGACATGGCGCCCGTAACACCCACCTCCATGCTCTTCACGATCGTGTTGCGCGTGGTGCCGCTGTTCGTAGGGCTGT
CCTCACCGTCAACCTCCGAGACATCGAAGCCATCGCCGTTGTCGCCCTTCTTGTTCGAGTTCCAGAAGCGCGAGCCCACGCTCATACTCGGCATGCGCGG
GAAGTGGCGCTCCGACATACGCGCCTCCGATGAACGGCGGTTAAGGTCGTCGGATCCCGTGAGAGAGTCCATCAGCACGGTCTCGCGCGGCTTCTTCTCC
TTCTTGGAGCCCAGAGTGCGGAAGATCGACTTCTTCGGGGTCGTCTTCTTCTCAGTTACAACACCCTCCTCGTGAAGCTTGGCGATCTGCTCCGTCAGCT
TCTTGTTTTCGGCCTCTAGCTGGGAGATCTTCTTTTCCTTGTCGCGCACGGTGTCCTGCAGCTGGCGGACCTTAACGTGGTTGCCAGCCGACGAGAACTC
CTTGTCGCTCTTGAACTTCTCGATCTCCACCTTCAAGCTTTTCATTGTAACCTTCATCTCCTCGTTCTTCTCACGCAGCTTCTTGTTCTCATCCGTGAGA
GTCTCGATCATGCCACCAGCGTCGGCCATGACCTCCCTCGAGGCAACGGAAGCGTCCTCCGCCACCAAGCTGCTACGGCGCTGCAGCTGCGCATTCCGCT
CCTGCTCCTCCTGCAGAGCCGCCTTCAGCTTTTGCAGCTGGTAAGCCATGTCAGCCTCGCGGCGCTTCTCCTCGAGAGCGGCCAGGTACTTGGGCCGCTG
AATTGTCATGCGAACCACAGCCTGCACACGGATGACCATCGAGCGCATCTTAACGTAGCGGTGACGCTTGACGAAACCACGCACATACCGCTGGATGATG
ACAGCGTTGTGGTTGCTCTTCACATCGGCCGCCACCTTACGGCCTTGAATTCCTCGCCAGTGAGCTTGCGCCTTCACAAGGCCGTTCAGGAACGTGTTGT
ATCTCCGCATGGCAATCACGCAACGGATCACCGACTGCAACTTGATGATTGCTTCCAGTTGTCGGAGGTACTTGATACGCTGCGTGAAACCAAGCATGAT
GTTCTGCAGGTACGTCGCCTTGGCGTCCAGGAACTTCTTGCGACGGTCCTCAAGCTCTTCAAGGACGCCAAGCTGGAAGTATACACGAGTCTTACCCATC
TGGTACTGCGTGGGCGACTCGAGCTTCAACTTGTCCATAAGCAGCTGGCATTTTTCCGCCGCAGTCTCACCACCACTCGGCACAAACAGCCAGAACTTGT
CCAGGATCTCAGTGTGCTGCAATCGGTTCGGGTACGCCGCGCGCGAGATACGAATGGCCTCAATTACACCTGCGCAGCGCAACTGAGACACCACCATGTT
CTGGTCCATGACCGTCGCACTCTTGACCGGGTTGGGCTTGATGCAACGCACGTAGTGCACACGCGTCGAGTTGATCGTAGCCATCAGCTCTGTCAGACTC
TCCTTGAACTGGGTACCGACGGTCGTGATGGACAGTGCACCGCCACGCTTTCGGCGTCCTCCGGACGCCTCCGGAGCAGCTTCCTTTGGCTCCGGCTTCG
GCTCGAAGAGCTTAGCGATGAACGGCTTGGACGAACCGCGCATGAGCTCGGACAGATCAGGCAGCAGCGAATCCTTGTGCTTCTCGAGGAAGCCCACCGA
GTCGTACATGACCGGAGCGGCGTAATGCTTGATCAAAAACTCGGTGCGTGATGTGCGGGGGAACTCGATCACGTGCGCCATGTCATCCTTATGCAGGGAA
GTAACCTTGGACATGAACGACTCCTCGTTACCCTTAGGACGCATCACTTCTTCGTTCAGCAACGAGATAATACCCATGCGCGACTCAATCACGGTCAACA
CATCCTGGTTATCCGCGTACTCGATGTGGTCCCAAACAatgccttcctcctcgtactcgatctgcacggtcttgaaaacatcctgggtgaacttctgctg
aagcttctcgttggcgtagttgatgcagaactgctcgaacgagttgtgcttgaagtgttcgaaaccgaagatatcaagcacaccCACGTGGTTGGCCATG
TTTGCATCATCGGCAAGCGACTGGTTAATCGTGGTCACGAGCCAGTCGAACACATTGGAGTAGATGGCCTTAGCGAGTGCGTCACGGCAGTCCATAGCCA
GCTCCTTCTTGAGCGGCACGCTGTAGACGTCGTTTACAGCGCGCATGGTGCGCGAACACAGGGCCGTCTGAAGGGCCTCCCACGTAACACCCAGCATCTG
CGTAGCAGAATTCGCGCCGCTGTCGCCCTCCGTGATGAGAGACTTCTCGTCATCCGACGGGTCGGACTGCAGCTGCATCTCACCAAGGTGCAGCACACCA
GCCAGCACCTCGAACAGCGGACGCTGGTCATCGCGCGACAGACCCACCAGCTCCAGCGCATCGCGCGTCTTGTTGAAGTGATTGGCGTCCGAGAGCCCCT
CGATCTTCTGGGCCGTGTTGTCGCCCGTGTACACGTAGTGCTTGCCCGACTCGAGCTGCAGCTCGGGGGCAATATCGGGGGAGTCcagcagctggtagaa
gatgtggtagttgcgctcgggcgcttcgtgctgaatgacacgcgtcttctccagcaggtaggtgcggcacttggcgcccacgagcgtgccgttcttgtcg
aactgcagctgcgtgaacttgccgaatcgactcgagttgtcgttgcgcaccgttttggcgttaccgaaggactcgagcagcgggttgacctcGATAATCC
TCTTGATGGTCGAGTTGTTGAGACCGCCGGCGATGGTGGCCAGGTGGTTCATGAGGATCTTGGTGGTCTCCGTCTTGCCGGCGCCGGACTCTCCGCTCAC
GAGGATGGACTGGTTGCGCTCCGAGCGGCGCATGTTATCGTAGGCGGCCACGGAGGTGGCGTACACGTGCGGGGGCAGCTCCTCCTTGGGCTGGTTGAGG
TAGCGCAGGTGCTGCTCCTCCGCGTAGAGGTCTGGcagccacttgtacgggttcacggcgatgcagatgtcgcccgtgtacgtgtagggcAGCTCGCAGA
GGAAGCGCTTCTTGACGTTGTACAGGATGGCGGCCTCGTGCAGGTAGTTGAGCGTGATCATGTCCTCGATGCCCTCGGGCCCGACGTTCTCGTTCTGGTA
GGGCAGCGACTCGAGCTGGTGCACGGCCAGCAGCGCCTTGGTCTTCTTGGACAGCATGTCCACGCAGCGCTCCTCGGTCTCGCCGTCGGGCAGTTCCACC
TTGCAGTAGATGTTGCGCGTCTTGCCGTCGCCCGAGTTCTCGTCGCGCAGCACCTCGGCCGCGAGCCACACGTGCGTCTCGTCCGGCACGAAGCACTTGG
CGCCCACCATCATCTGCAGGTCGCTCATGGCGTCTCCAAATCAGGCAGCGCTCGGGGCGGAGGACGGAGGGCGGAGCGGGTGCGCGGCTTGGGCGAAGGA
AAGCGGAATGCCACGACAGCAAGGGGGGCTCTGGCTGGGCAGGATACCGCGCGCGCAACCGGTAAATGGAGCCATGTTCTGATGTGGCAACTCAACTCAC
GTGGCTTTTGTATCGACTGCGACTTGAAACCCTGATCCAGCAACTACATAGCCCGGACAGGGCAGCTGGGCACGGACAAAACCTCTGCGGCAACGCCGGC
TGGGATCGACGGCGCGCGAGGATTTGTGCGCCCCCGCGATGCAAGCAAAGGCTCACAGCCGTGGCGCCGAGCAGTCAGTAACCTATCCGGTATGCGGCAT
TCAACCGGCGTAATTGCAGTGCGTGCTTCACGTGGCGGCGTATCCCAGACCAAAGCTTCTCACGAAGCAACACGTGGGGCAGCAGCGCTGACGAAAGCCT
CATTTGAGTGGTTCGTTTTTGCACCATTATGATTTACCGCCGCGGAACCGAT