Description :
From Genome Similarity Track
Location :
Scaffold_586:11287- 12964
Transcript NameFunction/comments
Phyta_totarag9460ATP-binding Cassette (ABC) Superfamily

Sequence
1677 bases(100 bases per row)
GAGAAGGAGACCCGTTCACGCGAGTATCTGAAGATTTTGGGTATGTCGGAGAGCGCTATCATCTTGTCGTGGTACATCACGtacttcatcatcttcgctt
TGAGCTCAATCCTGCAAGCCATCGCAAGTAGCGCCGGACTCTTCCCGAACAGCGACCCCGTGTTGATCTTCATTTTCTAcctgctcttctcgctcagTGT
GCTCGCCTTTGGCTTCTTCATGAGCACACTCTTCTCTCGTTCTCGAACTGGTTCCTTTGCTGGTATGgtgcttttcttcttcatgtactTCGTATCCAGT
GGGTTCTCGTCAACATCCTCGGTCGATTCGAAGACTGGGGCGTGCTTGCTGCCACCCGTGGCGTTGGCCTTCGGAGTCCAgtcgctggctgctgcagaat
cGACTGGAGTGGGCATGAGCTtcgcctcgtccagcacggttgtcgacaacttcaagttcggTTCTGCGATCGGaatgctcttcttcgacatcatcttcTA
CACTCTTGCGGGGATTTACTTTGAACGCGTCATTCCGCGCGAGTACGGCACCGTCGAGAAATGGTACTTCCCGCTACAGCCAAGCTACTGGATGCACGCC
GTACGCTCGAGGGGAAACATGAGCAAGGTCAACGATGTGGCCAACAATGTTGTCAACGGTAGCCACGCGATTCTTGACATCGAGAACCCTAACATGGAGG
CTGCTAGTGACGAATTACGCAACCAAGAGCGCTCCGGGGAAGCCTTGGTAATTCGGGATATCAAAAAGGAGTTCGTCGTACCAGGCGGAATCAAGCGGGC
CGTTCGTGGCGTGAGTCTCGCCGTGTACAAGGATCAGATCACTTGCTTACTAGGTCACAACGGAGCAGGCAAAACTACGCTCATATCGATGCTCACAGGT
ATGATAGCACCTTCAGCGGGTGATGCATCATTCCGCGGGCTGTCGCTCGTTCATGACATGGCAGAAATCAGGCAGTCTCTGGGACTCTGCTTCCAACATG
ACGTTCTCTACAGCGAACTCACAGTCGAGGAGCACTTGCTGTTTTATGGACGAGTCAAGGGATATCGCGGTGCAGCTCTCCGGGACGAGGTGAACACCAA
GATAACGGAAGTGGGTCTCACTGAGAAGCGCCACGTTTTCGCTGGTTCTCTTTCAGGCGGCATGAAGCGAAAGCTGTCAGTAGCGATCTGTTTGTTAGGT
GACAGCTCGCTGGTGTTCCTGGATGAGCCCACGAGTGGCATGGATCCTTacagtcgacgaagcacCTGGGAAATTCTGCTGAACAACCGTGCTAACCGTG
TCATGGTCCTCACAACTCACTTCATGGATGAGGCTGACATTCTGGGCGACAGAATCGCCATTATGGCTGAGGGCCAGCTTCGTTGCTGCGGCTCGTCACT
TTTCCTCAAAAACCGCTTTGGTGCCGGATACAACTTCACGCTGGTCAAAAGCAGTGACCCGGCCGCACCCTGCAAGGAAGCACAGCTCCAATCTCTCATT
ACATCACGCATACCAGCAGCCAAGGTGTTAAGCAATGTCGGTGCCGAAATCGCTTTccagctgccgctggacAACACTGCTTCATTCCCGCAGCTTTTTG
AAGCACTCGATGAGAAAATGGGCGAGTTGGGTGTGCTCTCCTATGGCATTTCAGTGACGACGCTCGAGGAGGTCTTC