Description :
From Genome Similarity Track
Location :
Scaffold_54:112834- 115426
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15805hypothetical protein

Sequence
2592 bases(100 bases per row)
TTTCCAAAACTTAAAATTAGAAGGTGTTAGTGCTGTGTATGCCACACTCGATAAAAATCCTACGGGTCAATGCTTCAGCATCACTCGTTCGCTCATTCGA
GAATTCGCCGGTTTTGATACACATGTCGGGTTTGGGTCGAGCTAAAAAAGGAGGGGTGGACGTCCAAAAGGGCAGTAGGCCTGTCCGACCATCACACGTA
TTTGATGCCAAGAAAGACGAGGAAGGATACCCGAGGCGTCGACTTTTTCGTGGGGGAAGAAGAGTTAAAGCGCTATATGGACCGTCTCGATATTGGTAAG
CAGGTAGAGCTTGTTTTCATTATATTAAGCAATTCTAACATGATCGCGGCATTTAGAGACAGCCGCAAAAGCCAAGCAGGAAGCGGTGACTTTGCCTGAA
GCTCCGGGGCCCGATCAGAACCTACCCAAGGGCAGCGTGAGTTCGGCCGACGGTCCAGAAGGTATGTGCATATCTTACGTTGTCTGATACTGGATAGAGG
TTGCTGAATATTGTATTGTACAACTTGCCGCTTTAGCAGTCATGGTAACGCAGCACGAGAAGACCGCATCCGAAGACGAGCAGAAAACCGGCGACAGAAC
AGAAAGTATCGTATAGTTGTGTAAATGTGGCGATGTGCGTGCCAGCCTGATCTCTATGATGTGTTGTTACTCGTGTAGATGCCAATATCGGCTGTGTACA
CAGTCCTAGTCACCCACAGTCAACTTCGCAGTGCGACCCGGCACCGCGTGAGTCCGTAGCGATGGAGGACGTGAGAGAGTCCGGTGAGATGGTGGGCAAT
CGTGAGTTGGATGCAATGGTGGACGAGAAGTTGGGCCAGCACGATTCCGGCGAGGTAGACGATTCGTGTGAGCTTGACAGCGCGGAAGAACCCACACGGA
ATCTGGATGAGCAATTTCGTTCCGTGGGCGACGATTCTAACGAAGCGGAACCTCGCCATTCGTCAGCAAACGCTGCAATTTCTTCAGGTTTGTTATCCTG
TATATACATGATTGTAATACAGGCTAATTTTTCAAACGTGTGTGTTATTGAAATTATAGATATCAACCTGGTGCAAGACTTGGATGACAATAGAGAGTAC
AAGGCGATGGAGTCAGATTGTGAAAGCGATGATGGTGCTTCACGTGGCGACGAGAGTGAGACGGAGGGAGAGATGGCTGACATTACCGAAGAAGTCCACG
TCGGGGATGAAGAAGAAGCTGATGATCCTCTGTTCGACGCATCTTTGATCGACGCAGTTGAGAGGGGTTATCGAGTATTGCGAGCGGCACGATAAGCGCC
GACATCTTGAAGAATATGTCCATTTCTGGGTGGGCTAAACCTTGAAGTCTATATTTCAGAAAAAAAATGCTTACGACTCTGACACGTGGTGGCCTTCTTT
GCGTATTTTAATACACGATATTGGATTAGCCTGTATCGCTTACCCATGTCAAATTGGATGATACAGGATAGTTCTTTTGCACCATCATAGGTGTCGGGTG
AGTTGTCGCTATCTAATGTTCAGGATAAAAAATAATTTACGTTAACTATCGTAACCCTTCCCCGACATACAAGTTAACGGAGCTAGGGGTTTAGGGAGAT
GACCGCAAACGAAAAGCCTCGCGTTCAACGGGTAAATGCATGAGTGTTTTCGCAATATAATAACATTGTAAAATTCTTAGAACATAAGTTCTGTTTACAA
ATAGTTGTGATAGTGGATGCGACGAGTTTTAGACAATTATGAGGGGGTGCATTAGTTCATCGCTAAATGGTAAACGCACTCAAGCCCACAGGAAACGTGG
ACACTTAATCTGAAGCAGAATGATTGAGACATATACACTTAACTATATCGATAGTCGTTAGTATAGCTATATGGGAGTTCTACATGAACGCTATAAGTCT
TGAAACAACAATACTAACACGTCAAACAAAAACAAGCAAGTATATATCCTTTTGGTGCAGTGTTGTTCGAGCAATAAAACGAACTGATGAAACACGCCAG
ACTGCAGACTCCACAATGATCGAGTAGCGAATATAAAAACAATAAAAAGTATGTTAATAGCATTAGGCGAGACTATCCTAAACATTCGTAAATAAAATGT
AGAGTACAATTAATCAGAGAAAAGCTTTAACCTGTTGGCATAGTTATAAGCAGGAGGCTATGATAGTAATCGTTTAAAAAGGCTACGATCCCGCCGAAGC
AAAGCGGAGGCGGGAAACACCTTAGCGATTAAACATAAATTGCCTCCGCGTAGCGGCGACGCTCGGCTAGAGGAGATCGATGAAATTGCATGCAGAACCA
ATGTAATAGTTGCGCACATAATCACTTGTTTCAGAACTAATGTGTTTATCTTAGCCTTCCTATCTGCAACAGTACCTACGTCAACTTGAAGAATTTGATT
TCGCTAGAACAGAACAGATTATACGCGGAACAATTGCATTGGTTCCACCGTTGACACGAACAACTAAGCTCCTATTGTATTAGTTTTGGAACAAAAGCAT
TACGCGTGGAACTGCATACAATATCAGCAAATCATTAGGGTGCGAACTACACTAAAAACCTTAACATGCGTGGTAGCTTCCACACCTCCAAA