Description :
From Genome Similarity Track
Location :
Scaffold_261:11282- 14058
Sequence
2776 bases(100 bases per row)
GGACCTTTTGCAGTCCCAGCCAACACATGTGCGCTCGTCCACCATTCGCCCTTCCAAAGTCAATGACGACGCCCCCCGACGTTTCTATGTCGGACGTCTT
AAGCGGTACTTTGACCGTAGGGGGTTGCTGACTCGCAGACCCCCCCTTGACCCCAGCTCCCCGAAGCGAGGGCCCGGTCACAGTCGTCGACGAGGTCGTC
GGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGAACCCCGGCGCCATACGCCGAGT
ACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCG
AAAGTCCTCGTCCAGATCGGTCGAAGAGGCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCAGCAGGTCCAGGCGGCCCGCAAGACGAG
CGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAAC
CTCAGGGTCCTGTGTTGGACCCGCAGGAGAAGCACTCGGACGAGAGTGGCGTTCGGGAGGAGCCGAGTACTCGTACTCGTACGAGGGCACCCCCGCCCCT
GCTTGACCGGAATGGAGAAGTCCACTTCCATGTGGAGCGGATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTAT
GCCCACTCCGAGAACTCGTGGGAGCCAATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGT
AGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTT
GGCAGCATGCGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGTTCCCGTAACT
CCGTGGGTGAGTACTTAAGAGTCTCCACCCATGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGACAGTTCTCGGGCATATCCCAGGGGTATCCCCA
AAGAGGATAGAGACCACCCTGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGGATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCC
TCCAAGTTGTCAACGAACAACTGTTCTTTCTGAACAAGGGCGCGTTCTAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAG
CTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGTCACCACCGAACCCCCA
CGCACACGCTGGACAGCTTGGAACTCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATAGCACCCTCCTCTTCCTCTTCTTCCT
CCTTCTCCTCCTCTTCATCCGAGGAGTCGAAGATACTCCGATAGGAGCGACGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCTGTACGCTTCTT
TGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCTCGCGCAAGACCCTCAGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCT
TTGGGAGCGCCCTTAGCCTTGACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCTTGATCACTAGCGAGTGACTGCACGCTGTCAT
CCTTGTGCTCACTGGGTACTGGGCTGTGCCCTTCCACAGATCCCGCAGGAGCATCGTGCGTGCTCTCGGACTCGGCTTCATCCTCACTGCCAGAGTTGAA
CTCACGTTCCACTAACCGAGGGTTCGGACGATTGTCTGAGGCCGAGGGCGACGGACTGCGGCGCTTGCTTGCTCGCTTGTCCACAGCCGCGTCACCCGAG
GAACTGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCCGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGGCAGCAGCCT
TGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGATTAACGGTCGAAGTGGAGACCCAGAAGAAGAGCGCACATACTGCTGCTCGAGGCT
CTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTCACTCTGATTG
GTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATG
ACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTCAAACGACATTGCATTTTCTATAGGTAACTTATAGTTT
GTATTAAACCCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTATTTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGTA
CTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACA