Description :
From Genome Similarity Track
Location :
Scaffold_285:11282- 23673
Transcript NameFunction/comments
Phymu_g8071cAMP-dependent protein kinase catalytic subunit beta, putative
Phymu_g8072mannosyl-oligosaccharide alpha-1,2-mannosidase, putative
Phymu_g8073hypothetical protein PHYSODRAFT_557349
Phymu_g8074hypothetical protein PHYSODRAFT_313472

Sequence
12391 bases(100 bases per row)
gccacctgTGGGGCAAAAGAAATGTAGGTGGAGCCCGGCTCTATATAAAAGCACCGGCGAAAATCACATGTCAACCTTGGCTTGAATGTTCATGCTGCAA
ATCGACCGTTGTGAACTTTTGTTACAGATAGAAACGACCACCCGACGCTGTCGGCCATTGTTGAAGTGACCTGTAGACGACCAAATGGCGCCAGAGCGGA
AAACGATTTCGTCGCCGAGTCTGGTTGCCAGCAGGAACCCCAGCTTCAGCAGGCACGCCATGTGACGCGTGAGCCAACGTCCTCGTCGAGTAAAACGTTC
ACGACGCCGCGCCATCTGCCGAACGGCCTCGCTTACAGGCTCCGTGTCAGGCACGAAATTTGCACGCTGGCAATcaatgctgcttggtctccGGCTCGCT
GATTACCACCTTGAGGCGATTGCTAGGTGACGCTCTGGATATTGTCGAGCGTTGGTTGCGCGTCAGAAGTTGCAGAACTCACGTCTGGCCGCGTCATTGT
CCAGCGGCGGTGTCTCCTCGCTCGAGCTCGGGTAGTCGTCGAAGTTGGTCGTGTCGCCGGCGCAAGTCACGTTGGGGATGAATGGGGCTGCTACTTGCCG
CCGCGGGACGGAATCCCAGTCCACGTTCTCAAACCACACATGCTGCTTAATTGCGCCGACCTCGCTCAGTCGTTTGCCTGGATCGCACTGCAACATACCG
CGGAGCAGATCCTTCAACGTGCTTTGCATGTACCGCGGCCAGTAGATCTTGCCCGAAAGAATGCGGTTGTACAGCTCAAAGTGCGACTCGTTCTTTCGCG
ACGTAAATGGCGGCGACCCGCTCACCAATTCGTACACCACACAAGCGAACGCCCACCAGTCCACGATACGAGTATAATTGCGTGCTTGGTGAGAGAGCGT
AAGCTGCTCGGGTGCCAAATACTGCGGTGTCCCCACACTTGATGACGTTCGTTCATTTGGGTTgcgaagctgcttcacgaACCCGAAATCCACGACCTTG
ACGTGTCCCCTTGCATCCAGCAAAATATTCTCAGGCTTTAGATCGCGATATATGAGGCCATTCTCATGACAGCATTCAATGAATACGAGGAGTTCTGTGG
CGTAAAATTTGGCTTCGTCGTTGGATAGACGTCCAACAGCATGGAGGCGATGGAAAAGCTCGCCACCTGGGACGTACTCCATCAGGAAATGCACGTGGGA
AGATGTGGCCAAACTCCCGAAAAACTTGACCGTAAACGGATGCCGAATTGAAGTCATTTTTTCCATCGCATCACGCTCGGCTTCAAGTTGCGGGATCATC
TTTTTCACGAtcacgtccttcttctttacCGACTTGAGGATGTAGTAAAGGCTCGAGCGTTTATGGCGGACCAACCGCACCTTACCAAGCATCCCGGTGC
CTACGatatccagcagctcgaagtaGTTTTCCACGCTAAAGGGCTTTGGCGGCATATCGAGTTTTGTGCCAATCCAAGGTACATCGTCCCCTGGTGTGTC
GCTCTGAGCGTCTGTAAGCTCACCATATTTGTAGGGACAACTTGACGCGGAATCGATAGACGCTGCGCCACCCATGAGCACTTTACGTCTCGGGATGAGA
CCGCACTCATCTACTTTGCAGTGACGGACTGGACTTGATCTTGATCCAGGAATCGTTTCATCAATGCTGGTCGGCAACCTCAAAATACGACGCAAAAAAT
AGAGACGAACCTGTTATCTAACAGGTTAGACATCAAGCTCCGTTCTTTGATTAACGTGACTGTAGGTTAGCTCATGTACAACACCGGATTTGGAAATGCA
GCGCGATATTAGGACACGGGAACTTCAGTTGTCTAGGAGTCAGTTGTCGCGACCGGGAACGGGTGGGCTTCCGTGTTGAAAACGATTTCGTCCAAAGCCA
GCATCGAGTCATCTGAAAAAAGCAGGAATAGATACTTGAGCGTCtcggcgatgaagaagctctccaTTTCGTTCCGGAAGCCAATGTGAATAGGGCCCTT
GGCCACGTTACCAATGCTTGCATACCCGCCGCGCTCTAATCGACAATTTTTTTCAAACGCCTTCATGATTTCACGCCCGTACTCACGATACTTCTCATCC
TTCGTGACGCGATATAATACCATCAGACTCTCCACTGTTTCAGGACGTAAGAGGTTGAAGGCGTCGGTCGCACTGACGAGCAAATCCTCCTCGACGTTTT
CCTTCATGTTGAAGTACATGATCTCAGGGGCAAGTTTAGCCTCCATCTGAGCATACATTTGGTAGCAGGTCtccatgagctgcttcgccAGTGTAAGGTG
CTCTTCGGGCATTCCGTTATGGTACCCCAGTGCCAGCATTCCGGGAACAAAGCACACCAAATGGTCCATCTTAGGCTCAAACTTGCCGTAGACAAGCTCG
CCGATGAACACAAAGTTGTTGGGTTTTGatttgcccagcagcttgtccatgATACCATCCACTGCAATCATATACTGCGTCTTAAACTTGTCATCCTTCT
TGCCTGACAAAAGCCACTGTGAATGCAACACACCCACACCGCACAAAATTAATATCGAATGTACGTTCAGACACTATGTCAATCATCCTGTACCTGCTTC
AGTAGGTATTCATAGTAGCTGTCTCCGTTAGCACCCATTGTGATTTTAGACGTGGTGATTTTTCCGCTCTGCTGATTGATTTGAACTGGCAACAGACCGT
TGTTATacttctcctccacttgCTTGGCAAGCTGAattcataaaaaaaaactgttgATTAGTTTTTGTCACCAACGACCCACATTCCAACCGGGCGTACC
GAGTCCGAAATGCGCTCAACCTGCTCTTGGTACTTCGGGTATCGGGTTAGTCGAGCAAGATACTTAAACTCCATCTGCAGCGTCCCAACTTCCGCTAGTG
AAGGAGCCGCACGTGTTCGCTTCGTCTGTTATCGTTTTCGCAATATTGTCATCAGGACCTCATTTCCCCCCTCTGCATGTATTCTACTTGGTAACGTACC
ACAATATCGTAGTCCTTGGCAGGAATACCGTGCTCATACACATCAAACGCCGGAGACAAAGCCATCCCCAGCTTATTCGCAATGGTCAGCAGGTGCACAT
GCCCTGACATATAGTACGACGACAGCAGACCTCCCATCAAGCGAATGGTTgtctcgaagaagctgatgaatCCACTGAGGAAGATTCGCCGCTCCATATT
ATTGGCCACCCATTCACTCGCTCGGTCGAACTCATCGAACATACCAACAAGATATAGTGTGTCCAGCGCATCTACAAGCGTCAGTGCCATATCATGATCC
GGCAGTCCCGTGCCCTTGTACGTCTTAACGTTGAGAGAGTCATGACCGTACGCGTACTCCGAGTATCCCTTCCAGGCCCATTGCACCATATCCACCACTT
GCTTCTGGTCTTCATTATGCAATGCCGGGTCGTAAGGTGCTCGCCTCCGCTGTTCCTCCTCATGCGTTGGATCACTTGCCGGTGGTTCAAACACGAACGT
GTCCACTACCGGTGCCGGCTCAGGCGTATCCGCTGCATGCTCGATACGACGTAAGTTGTTCATCCAGCCATTGTCAGGCTGCTTGTCCGTATTGCTGCGT
TGCGTCCCCACAATACTGGAGCTCCAGAAGACCCACTGGGCGATGATCCCGACACAAAGCAAGCCTAGCAACAGTCGCAGCACCAGAACCGTGGACAGCG
AACGGggcgacgagaaggagcgagtACTACCACTTCGGCTGTAACTCTTGGTAGGGAACTGTTGCGTTACCAAGGGGGCCATCGGCGGCTCGCGAGCGTT
GCTAAGTCGACGTGCACGCGGCTCCATGATGACGTCTATTGTTGAGGGGAAATGGCACTGACTGACTAGTCACTATTGAAAGTCATTATTACGGGGTTGT
ATTTTTgtatttttgtttttggaTGGACGGATGAGAAATGCGGGCAGATGACGAGGAACAACTTGTTTATGCGTGTCAATTGAGAGCTTGCTGGGGTCTG
TTGGGCTGGGTGAGGGGCAGAGGAAACTCTGGTCTCTGCGTGGTCCAATGCCTCGGCGAGTTCCTTGAGAAAACGACGAGTGAGCGATCCGGGTCTTAGC
GATCGGGATCCTGATGCCCCACTTACGTATTGTctgtctgtacatgtagtacccTACTGGTTGTGCTAGTCAAGAGTGCTTCATGATcaggatgaagaag
cacaatGTGATGAGCgtcagcaacaagaagatgcagcgttCGGGTCTCGTGTTGCGCTGGTATTTCTCGGCCCGTTCGAGCTGGCCCAGTCCTGATCGCA
TTCTCTCGACAACCTGGCAATAGCGAGGCAAACAGATGGAGTTAGGTGAATTAGCTACCAGTTTCTTCTCTCGGTGATTGGGGTACCTGCTCCATGTTGT
AGTCGATCCGGTCGATGAGCGTGCCTTGGTCGATCACCATCTCTGCTACCTCCTCGAACATGGTTGCTAGTGTCGCGACGGACTTGGCAATTCGTTGGAT
TTCAAGATCTCGAGTCCTGATATCGTACTCCGTGCGGTCCATTGCGATGGCAGTGGCCTTGTTGCCGAATCCGAAGCTTTCGCCTGGGATTCCAGCCCCC
TTTTCCATTGCATCAACGTCGAATATCTCGCTCCCGAActtttgcagctgcagacgctggaggtACTCGCGCTGACGTGTTCGGAACTGAATCGATATAT
CCTGAAGACGACCTGCTATTGCACGCTGTGTATTCAGCCGCACGAGACGGTCTGCTGGAGATGGACTGGGCTCGCCTCCAACGAACGCGTTGGTGATTTT
CTTCAGTGATCGATCGGCTTTGTGGAACAATGCAGTAATTTCTTCAGTGAGGCAATTGATCTCACGCTCTTGTTGTGCCTCCGAGTCATCAAAACGGATC
ATCAGTCTTCGAGtatgcagcagctgcaaatATTCCACTGCATCAACGGACACCATCACGACCACAACAAAACACATCATTAGTGGAGGACGTCACGCTC
CAAGACCAAGCATTTCACCAAGATTGTACATTTGGCGTGTAATAAGCGAATGGACTCGTCCGCGCTGTCTGCAAAACGTGTCCACTCTGGCTTGTGGATG
TCACCGTGTCCCGCCCCAGGAAGCACACCTGCGTCTTGcaacagcgccttctccattgcGTGGGACTTGTGTCTCTGCGAAAAGTATAACCATATCCAAG
TCAACATCCTGATGGTGATTGCCACTCCGACGTCTCCATTCTGGTACCTGCTTGGAAAGGAACAACGCGCCTAGCAGCGGCGAGCTGTCCAGTCGTGGCC
GCATCTGGAagcgcaagttgcgcttGCGCAGGTTCGTTCGTCGCTCGAGGAAGCGAGCGGTAAGATCGCGATGCGCCATGCTCCTTTTCACTTTGTCAAG
ATTATCAGAAGATCTTAAAACGTCGCGGAGCGATCTTAATTTTCCGGTTTTACAGCCAATCATTGGCATGCAACATCCAAAGTGTCGGTTGCCAAGGGAC
CTTCATTCCTGCTGTTCATTCCGCATCGATGGCGGACGTTCCTGGTGGTGTCATGGGCTCGGCGCCTCCGCCACTGCGCTGGAGCAAGCTTGAGGCGGTG
GCCAGACGCAATGGAGAGACACCGACCCGCCGCTCGGGCCATTCGTTGTCCATTGTGGGCTCCAGCGGCTATTTGTTCGGCGGTTGTGACTATGCGGAAC
CTCCTGGACCGACAAGCGACTTATTCGCACTTAAGATAAACGCGAATGCCCCCAGCGAGTGGGAGCGACTGCGTTCGCCTCTAAGTGGTGCGTGGCCTCC
TCCCAGATGGAAACATTCAGCGACGGTGGTTGACAACAAGATATACGTATTCGGCGGCTttcacagcagctcctcgaggTTCAACGACCTTTGGATCTTC
AATCCCATCACATTGGACTGGAGCCAGTCTGGGGCTGTTTCGGGAAGTGCTAACAACCATCGGGCCAGTGTGGCCAAGCCCGTGGCGCCAACACTGCCAG
CGCCAAGAGGAGCTCATTCGGCCGTTGCCATTAGACGCGTTATTTACGTTTTCGGGGGATATGGAGGTACAGGCTACGGCAGGAAAGACTTCGACGACCT
GTATATGCTGCGGACTGATGACTTGACGTGGAGCAAAGTCACATGCAAAGGCAAACCACCTGAAAAGCGAGCTGGGCATCAAGCTTGCGCTGTGGATGAT
CTGATGCTGGTGTGTGGAGGTTGGAACAGTGTAGCCCAGTTCAATGATTTGCATATTTTCGACTCGACAGTGAACTCGTGGACTCTTGTGGAAGGTACAC
ATATGGCTACGACACTGCCTAGGTGGAACCACGCTTGCTGCGCGGTGTTAGCTATTCCACATGCAAAAGTTTTCGTTTTCGGTGGTGTCGTTGGAGAAGC
CAACAACTACAACGCACAAGGCAGTTACATGAACGATTTGAGTATCCTTGACACGGGTGACATGAGCTGGAGTATTCCAGAGATTGAGGGCGCTCCACCA
TGTGGGCGAAGTGATACAACATTAACCTACGATGACAAAGGAAGCCGTCTAATTGTGTTTGGTGGCTGGGCTAATGTATGGCTCAATGATATCTTCTACC
TAGATGTAAGCTGTGTCGTCGGTCCTCCATACGGCATTACTGGCATATTCCCTGACTTCGGACCGATTACAGGAGGCACGGCCTTAGTCATTGAAGGCAT
TGATTTTGTCAACAAACCAGTGAGTATCAGATTCTCGTGTCGAAAAGGATCGGTGGATGTTCCTGGGGAATATGTCAACGACCACACGCTAAATGTGGTT
GCGCCAGACTTCACTGCGTACCCTGCTGGTGATGTCCAGGTCCGCGTGGCACTACAGGGTGACTCGTTCACGACGACTTTCCAAACATACAACTATTTCT
CGGTCACGTATGCGCCATTATGTTTTGCATATGGGCCAGGTGTACTATCGGGCGGGGCTAGCGGAGAACCAACATGCTTTATTATTCAGGCCAGAGATGC
CCAACGTAACTTAAGGGCTCGTGGTGGAGATGAGTTTATCGTCGAAATATCCCTTGAAGATTCAGACCCAATGTTCTTGCCGACGTTGCAGATTCAAGAC
CTTCTAAACGGCAAGTACTTGGTAAGTTATACGGTTCCTAGCCCCGGGGATTATCAAGTTCGAGTTGAATTCCAAGGTACTTTTGGTGGCAGTGCAGGAA
CAATTCGTGGCTCTCCCTACACGGCTACGTTTGACGACATTGTTACTCGTGAAATGAACTTGATGACCGGAAAACTGGTACTGGATCAAGTATTGTATGA
TTTacaagtactgcagcaatcAACACGAGAATGCAACATTGGGCTGGAACAACCTTTGTCAGATCCGACCTGGACACCTGAGCAAGTTACGGCCGCGTTA
ATTGGATTGAAAGAGCATGTGTTCATGGTTGAAAAACGTGGAGAAGCGATTTCAGTATCGATTGAAGAACTCCGAGCTGAGATAGCGTTTCTTAAAGATG
CAGGGATCGTGGTGACAAAGGAGTTGGATATACTGATAGCGATCGAAGTGGCTTGGGGGGAGGTACTGAAGAAAGTTCCGGCTGCAAGCAATCGTATTGC
GCCATTAATTTCGACGCAAAACTTAAAGTTCCGTGACGAAGTAGCTGCCTAcatggaagagctgcaagcaAAAGAGGCCCAGCTGAAGTCTAAGGATTTC
TGGAACTTTTCAGTTGGCGTTAACGCTGCAATTACACTGATTACTGAAGAGCAGGCTAATGCAGAAGTGGATGGACGAGTTttcaagcagaagaagcaca
tcGCTGAAATCTTGGAGTGCGAAGATTTAATGGAGCCCTGCTCTGCCGTGTTGACATCCATTCAGCGCACTCTTGCACATGGCCACCAGATGTGGGAATC
CATCACAGAGGTGACGAGGAAAATTGATCTTTCGCGAGAAATTCCATGGAGCATGATCGATGGTATCGTattggaagaagaggctAAGGCATTTCTAGCG
CTGGTAAAAGCCACCCATAAAGATATCCGGGATTGTGATGCATTCAAAAAGTTCGAACGACTCGTAAAAGACTTTCTCAGCACGTGTCCACTTTTTCAGG
CTCTGCGGCATCCATCCATGCGAAGGCGACATTGGCAGAATCTCATTGCAGTCTCTGGGAAAACTTTTGAGTGCCCTGATGATAATCCTTCGATGAAATT
TGCGGACATTTTGGCGCTGAACTTGCATGAGTTTCAGCGCGACGTTGAAGAGATTACGGATCGAGCTCAGAAGGAGGCCAAACAAGAATCCATCTTGCTA
GAACTTGAAAGCCGTTGGTCTAGCATTTGTTTGGCGATGACACCTTATAAGGAAACAGCAGTGCCGTTACTGTACATGGTGGAGGACGATGTCGAAATGT
TGGAGTCTGATCAGTTGCTTATCCAAGGAATGTCATCAGGGCGGAATAGCTTCTTTCAAGAGCAGACACAGCAATGGCGATCAAAGCTTATGCTTGTTTC
CGACATTGTTGGAGCCGTGCTGGACATTCAACGATCATGGTCGTATCTTGAGCCTCTTTTTATGCAATCAGAGGAGGTTAAACAGGAACTCCCTGACGAA
GCCGCTAGGTTTGAAGATGTGGATGAACTCGTTCGGCAAACGCTGCAGAGCATGTGGTCTCAAGATCCACCAGGAAATGTATTATTGGCCAGCCAGCTTC
CTGGGCTGCTCGATTTGCTTAACGATCTTCGTGCGCGATTGGAGAAGTGCCAACAAGCGCTCAAAGAATATCTCGACTCAAAGAGACGGATGTTCCCTCG
CTTCTATTTCATTTCAGAAGCTGATTTGCTTGACATCTTATCTAATGGCAGCAATCCACAGAAGGTCATGGTTCACCTTGAGAAGGTGTTCCTGGCTACA
CAtacactgctgctcgaaaaagaaaacaacgGATCCGTCAGCTCTATCGTGGCTACTCACTTCATTTCTAACGACTCCGCAAAAGAAAATATCGCGTTTG
AGAATAAGGTCCATCTGGAAGGAAAGGTGGAGCTCTACATGCAGACAATATTGGAGTCTATGCAACTCACATTGAAGGGTCATGTGACTCGTTCAATCAC
TCGTTTTCCAGAACAAAACCGTGTGGACTGGCTGTTGCAGAAGCTCCCGTCAGCTAGCGAAGGAACTGTACCAAAGGATAACATGgacgctgctcaagtt
gctcTGCTTGTCGCTGGAATTGAATACGCAAGAAGTGTTGAAAGTGCTTTTGAGTTGTTATCCAAGAGCCATGCGACAGCCATGAAAGAGCTTCTGGAGA
AAATCGTGATTCAGCTGAATGACCTGATCAAGTTGACTCAAACTAACTTACCCAAAGGAGATCGTCAACGGACAATGTGCATGATTACGATGGATGCGCA
TTCGCGAGATATTGTCCAAAAGCTGCTCTATGAAGAAATCACCACGCCTAGCTCCTTCCTTTGGCAGTCGCAGCTAAAACAGCGGCGCTCGGATCATCAA
AACCACAATTACCTGGAAATCTGTGACGCAACCTTTGACTATGGTTTTGAGTACTTAGGCAATGGCCCGAGGCTTGTCATCACTCCTCTAACTGATAGGA
TCTACGTTACGGCTACCCAAGCTCTTCACATTCAAATGGGATGTGCTCctgctggacctgctggaACCGGGAAAACGGAAACGACAAAAGACCTGGCAAA
TATGGTCGGCAAGATTTGCTACGTATTTAATTGCTCTCCTGAAATGGACTACAAGAACCTGGGAAACATATTCAAGGGATTGGCTAGTGCAGGTGCATGG
GGATGCTTTGACGAATTCAATCGACTTGCCCCGGAGGTCCTATCTGTTTGTTCTGTTCAATTTAAAGCAGTCTGCGATGGGATTCGAAGTGAAAGCGATC
AGGTTGTGATAGAAGGCGATTCGGTGAGACTCGACCCCACTTGTGGCACCTTTATTACGATGAATCCTGGATACCTCGGAAGATCAGAGCTCCCGGAAGG
CTTAAAAGCATTATTCCGACCTATCACAGTTATGGCACCTGACCTTGTCCTGATCTGTGAGAATATGCTGATGGCGGAAGGGTTCCGAGAGGCCAAATTA
CTAGCTGCAAAGTTTTTCAGTTTGTATTCACTGCTTCGAGAGCTCCTTTCAAAGCAAGATCACTACGACTGGGGTTTACGAGCAGTGAAGAGTGTGCTTG
TCGTAGCTGGAGCCTTCAAACGCGCCGAGTCGAAACTCACGGAGCAAGAAATTCTCATGCGCTCTTTGCGAGATTTCAACCTACCAAAGATCGTCAAGCA
AGACCTCCTTGTTTTTAATGGTCTGCTTAGCGACCTCTTCCCCAACTTAAACCAGCCACGAAAAGTTGATGAAGTGATGGAGAAatacgtacatgtagcg
tgTGAAGATCGCGGGCTTTGGCCCCATGAGCAGTTCCGACTTAAAGTCATTCAACTGGAAGAATTGGTAGCAATCCGTCACTGTGTCTTCATAATGGGGC
CTCCGGGGAGTGGTAAGACCGAGTGCTGCGAGACTTTAGTCGCTGCTCGAAAGAAAAAAGGTGAGGATTACGTGACAAAGGTAATTGATCTCAACCCAAA
GGCGGTTTCTACTGAAGACCTTTACGGCTATATGGTGCTCGGGACACGGGAATGGAAAGATGGTCTTCTGTCCAAGATAATGCGTGACGTGGCCAGTGGT
TCCGTCACAGACACTCGCCCAAAATGGATTGTATTGGATGGAGATTTGGATGCTAACTGGATTGAGTCGATGAATTCTGTGATGGATGATAATAAAATGC
TGACACTTGCGTCAAACGAGCGCATTCCCCTCAAGCCAAACATGCGGCTTCTTTTCGAGATTCGAGATCTCAAATACGCGACCCCCGCCACTGTGTCCCG
TGCAGGTATTCTTTACATATCTGACGATGATGGCTTTCAGTGGAGGTCGTTTTTGGCGAGTTGGGTAGCAACTAAAGGTACGTCAGTTCAGCAACGCACG
GCATTGGGGGAGGCTATGAACAAGTACATCGACCCTATCATTTCATTCATTAGGCAGTGTTGCAAGACTATCGTGCCGATACAAGACATTACCATGGTGC
AGACGTATCTTTATTTTCTTGACGCGATTTTGGACGTTGAAACCTTGCGGGACTTTAAGAAAGTGGATATTCTGAGCGGATTTATCTCGGTGTGGGCCTT
TGGAGCACCACTCACTATTACCGATGACGGAACTGACTACCGAAAACTATTTAGCGAGTGGTGGCGCAGTGAGTTTAAACACATCAAGTTACCAGCTCGT
GACACTGTGTTCGACTATTGGCTTGACCCTAACACGTTTTCCTTCGACACCTGGCGGGCATCGCCATACTTTAAGGCGATTCACTTCGATGGATCTGTAT
CAATGTCGTCGGTTACAGTACCCACGCCCGAGACAGCCTCGATTACGAGCTGGATGAATATTATGGTTCGTGAAGAGCGTCCGTTCATGCTGTGTGGTAA
TGCTGGCACGGGTAAGACCCAGTTGGTTCAGGGATTGCTCAATAACCTGGATGGACGGGTCTCTGGAGCTGTGTCTTCTTCTACACCATCAACGATGTca
tccattgctgctgccaaagGCCCTGCAACAAGCATGAGTATCAATTTCAACTACTACACCAATGCTCACGCACTACAAGTCATActcgagtcgaagctct
cgaagcgAGTTGGATCAACGTTTGGTCCTACCGTTGGAGATCAGTTGATATACTTCCTGGACGATCTGAATCTACCTCAAGTCGATTCCTATGGTACTCA
GAGCGCGATTGCGTTGCTTCGCCAATATTTGGATTACGGGCACTGGTACGATCGGGCCAAATTCTCGCTGAAACAGATTGTAAATGTGCAGTTTTTAAGC
TGTATGAACCCTAATGCCGGCAGTTTCAGCATTAACCCACGTCTCCAACGTCACTTCGTCACGTTTGCCCTGCCTCAACTTAGTGCCGCAAGTTTGCAGG
TTATCTACACAACGTTCTTGGAAGGTTATGTAGCAGATTTCGTTGAAGATATCCGTAAAATGGCGCAGCCAATTCTCAAAGCAGCGCTTAGTCTCCACGT
ACAGATTTGCAGTACTTTTCGTAAGACGGCTGCCAACTTTCACTATGAGTTTAATATTCGGCACGTGGCGAACGTATTTCAAGGGCTATTGATGGCAAAG
CCACCGACATTTGAAGACGCTCTCAAATTTGCGCTGCTTTGGATACACGAGTCCTCACGCGTATATGGGGACCGCCTTGCCTCGACGCAAGACCAAGCCA
AATTTACATCTATTgtgcaacagcaagcacGGAAGTGCTTTCCTGCTCTCAATTTTATGCGCTACTTCTCTCCTGTGTCGTCTGGCTCCGA