Description :
From Genome Similarity Track
Location :
Scaffold_122:11280- 12298
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_122-fgenesh-gene-0.2Sodium/hydrogen exchanger

Sequence
1018 bases(100 bases per row)
TACGTCTCGGATCCCGACCTTTTTTCTAGAATGCTTCTCGACTGACTCACTGTTGTCGTCCGAGCAGGGCTTCTTCTCGAACTTCTCGGCCATCATGCTC
CTAGCGATCGTCGGCACGCTGATCGCAACGTTCCTGACTGGCGGCGCGCTCATCTGGATGGGCAACGCTGGTCTGATCACCAAGCTGACAGCCGCGGAAG
CGTATCTGTACGGCTCGCTCATCTCGGCCGTGGACCCGGTCGCGACGCTGTCGGTTTTCAAGAAGAACGGCGCGCCGCCGCTTCTCTTCAACCTTGTGTT
CGGCGAGAGCATGCTGAATGACGGTGTCGGTACGTGGCTGAAGCGATGTTGTCGATGTCGTGACTCGTAGGATATCTAATGACTCTTGTGCGATGCCAGC
CATTGTGGCGTTCTCGCTGTTTCAGCGACTCATCCGCGAAGGCACGGGCGACGTGACACTCCACGATGCCGGCATCGTGATCAGCCAGGTGTTTGGCATC
GGTCTCGGCTCGGTGGGACTCGCCGCCATTGTGTGCTTCACGTCAGCGTTCCTGCTCAAGCAGGCGGACCCGGCGTTGCGTCAGTACCCGTCGTACGAGA
TCTCGATCGTGCTGCTGTCCGCGTACTTGAGCTACGTGGCGGCCGACCTCGCGGGGCTCAGCGGCATCGTGGCGCTCTTCTTCTCGGGCGTCTTGATGAG
CCACTACCACCTGTACAACATCGCTGACGAGAGTGCGACGGCGCTGCGCCACTTGCTGTCGACGGCGGCATTCATGGCCGAGAACTTCGTGTTCATCTAC
ATGGGCGTGAGCGTCGTGGCGTACTCTGGCTACTTCACGTGGGACTGGGGCTTCATCCTCGTCAACCTGATCGCGATCCTCGTTGCGCGCATGTTCAACA
CGTTCCCGATGTGCTTGCTGGCGAACCTCGGGCGGCGCGAAGGCGACAAGATCCAGTGGAGCTACATGTTTGTGATCTGGTTCGCCGGTCTCCGCGGCGC
GATCGCATTCGCGCTGGC