Description :
From Genome Similarity Track
Location :
scaffold_735:1128- 7312
Transcript NameFunction/comments
Pl_102682hypothetical protein PHYSODRAFT_309991

Sequence
6184 bases(100 bases per row)
TATATTGAGATTTTCAAACTCTAAAGCAATGCTGCGGCATATGGCTTCTTGGCGATCAACGGTACCAACACGAGCTGTTTCAGGGTTGGTAGTTGATCCA
ATACGGTCTTTAGCTGCTTGAGTGCATGCCTTGCTCGTTGCTGCTCGGTAATAGCGATAGTGTTGCACGAAACAAGTATGGAAACCACCTGTTGGAGCAG
TGTTGCCCAGTCTGAAAAGCTCTGTTTCTGAGCTTCGTGGTGGTGCTGCTGCAAAAGCCATCTAGTAAGGTTGTTGGCAATACTCTCGGAACAATCAAGA
GCGCTTCTATCTTGAGTGGATTGCTGCACCACCTCAATAGACTTGTGCAGCAACTCCAGCGAACAGACAGAGCCAGCGCGACGAACAACCAACTCGGCGA
TGACAGCAGCCTTGTTTGCGACGGAGCGGTCATTCCTTGAGTCGGTACGACGCGCTGAAACTGCTGTCTGCAGAGATGCAAACGCATTTGCTGCCTGCAG
GGCCACTTCGTGCTGTTGAATGGCATCAAGTTCGTTCCAAACTCCATTCTGTAGAGTTTGCTCAAAAATCGTCATGAGGGGTAGCAACAGCACCGACGAA
GCTGCTCGCATTAATCCGTTCGACTTATCACCGCGTGGTTGTGTAGACGAAGACGCAGCTCCGTGTCTCAAGAATTGAGCTGCTAGCCATTCCAGCAGAG
CTGCCTTGGTCACCAAATAAACGCTCCCCGATGGTGTGTGAAGTGCGGCCAGCAAAATACTCGTGATCAACGGTTGTGTGTGGGTATCAGCGAGTTCGGA
AGTGAAGAAACTCATCAACATTGGAAGTGCGTGGCGACGCACGAGTAGCGTCACATCATCATCGCTGCGTACTCCTCGTCGGAGCGTGTGCAGAAGCCAT
GAGCGCTCTTGGCGGAAAGTCAGAGGAGCCCGACTATTAAACAGCGAGTAGAACATAGGCACATCGGCTAGATCCATCGCTGCGCGAGCCAACAGGAAGT
GGTTCACTTGTGGGTACAGCACGTGTGTCGGTCGTGTCAGTACAGCAAGGGCATCATTCAGGAACACAGTGACCACCGACGGAACTTGTTCGAGCGGTTC
CTCAACACCATGGCGGAAGACATCCAGCAAAAGGTGCACCTGACGACCAGCTTTGAAGTCGCTTGTAGTTTCAATTGTTGCCTGCAGAGATTCATGCAGA
TGGGCTAGGATGCCATACGCATATTCACGAACCTTCTCGATATCTGAAGACGTAGCACGAATAGCAACGCCCAGCAAACCTTGCTGTACAATACCACCGT
CCGGCAAATCCGATGAGGAAATAAAGTGCGATAGCATTGGGAGGAGGAACGCTGGATCATAGGAACTAGTCTGTTTCTCATCGTTGTTTGCCAGGGCCTG
CTCCACATCGTTTCTGAAGTCAGCGTCAGGAATCTGTTCATCCAGTTCTAGTAGTGATGCATCACCAGCCGTCGACACTTCACGATCTAGTGGGAAATGT
TCAATGGTGGCACGAACACGGTTTTGTTCAAGACCTCCACCAAGGACCCAGGCTGAATCATCAACCAGATCATTGTGAGACAGCTTCGATGTTGTTGTCG
CTCTTGCTGCCGATGTCGAAATTGAAGACGATACGCCAAAGCGAAAGCCCATGCTCACCAACGTGAGTTCATCCTCTTTGGATCCCTGAGTCTCAAATTC
GTCAAATAATACCCGTAGACAACGATCGTATGGAGAGAGCGACATCGAATACGAGCTCAGCAACGTCTGCAAGAGTGACCGTGTATAAGTACTCGTGATA
CGAGCGAGTCGCGCAACAACGCGGATAATAACAAGCCGCGCAACGTCGTTGTCCACATTCTGTAGAGTCTGATCAAAACACGGGTGTTGCACAACGGCTT
CAAAGTGGGCAACAAAATCGTAGTCTACGGATGTAGCGTCATTTCCCACAAGACGCAACAGCGCTGCTGTCAAGCTCACAAATGCCTCGAACACGAACTT
GTTGGTACATTCTTGGACGACTTCACGCGCATCAGCAAGTAGCGGAAAAATCATTTTCAAAGCAGACAATTGCTTTTCTTGATCTTGACGCCTCAGCGAT
TCGACAGCGCTCTCCACCAAAAGCATGGTCGCTTCAAACTCGAGGAACCAGTCAGGGTGGTCTTCTTGATCATTCTGCGCGGTCTTCAGAGCAAGCAAAC
CACTTCGAATAAGGAAAGCAAGCAGCGCAACGTCCACACTTTCTCTACAGCCATTGCTACGCGACAGCAACAGTAAACCCAGAAGTTGCGTAGATGATAG
AGCTTCATCATCACCTGATTTCGCTAACTTCTTCATAATTACACTAGCTGACGCATTCAACGCACTAGAAAAACCATCGGCACATACGTGCCTCAACAAT
GCAAGGTATGTCGTCTGACTTTCCTGCGAACCCAATAGCACGCGCTCATAACACAGTGGGATCAAATCCTCCACTAGCTGGTGTAGAGCTGAGCTCACAA
CACGCGTAAACGCGTTGTAAATTGCTACCATCAGCTCACACTTCACTCTTTCATCCTTCTCATGCTGAAGGCGTTTCAATAGATGTTCCTCAAACACAAC
GGGGAACGCTGCAGCTTTGTTTCCGCTTTGAATAGCTGTGATAATAGCTCGCAACACACTAGTACTTGATGCTATTTGTGCACTTCGCACTACAAGTGGC
ACAAGAGAACTATCAATTGATGCCACAGCAGTGGAAGCATTAACGCCACCTAAATGCCCAAGTACCGTGAATCCAGTCGTGAAAAACGATAGTTGTCGCT
GGTTGTTTGGGATGTTCAATAACTGCCAGAGCCGACGCGTGAGCACCTTAGCGCGCTTGTAGTCCGCGAAGGAGCTGTCGTGCTCATTCACAGCATTTCT
TCCGAGAGATTCAAGTACATGTTCAATGAGCACCACGTGTGGTGCATTCACACTTTTCATGTTGGATTGGTGCAACAAAATATCTAGCACTGGGACACAG
ATTCTGGTAGGAACACATGAAGCCAACACAGTGATGAGAGGTACACCAGCGCTCTGAAGCAGGCCCCCCAAATCGCACAGTGATGCCAAATCTGATCCTG
GGTTGTTGCTAGCGTAAACTCGCAGAGCAACAATTTCCACAGCGGAGAGTTGTCGCCACAATGCAGTGCTTGAAATGCTACCAACCACTGCTCGAAGCTT
AAAGAAAATCCGTGCCACTATAGTAGAAGCAGGGGCGTCACCTTCTGAGGCAATCACGACTATCAGCAGATGCAAAAGCAGCTCGCACAATAATGCGTTT
CCATTTTTGAGCAAGTCTGGGTGGCTTGACGAGAAGAAGAATAGCAATTGTTCGCACATGCGCGTTGCATCCGTCACTGTTAACAGGTGATCCTTGACTC
TACGTTTTGTGATGTTTGTCACCGCCGAAATCACCGAATTGTGCTCCTTCGGTTCTTTGCTCGCGATGCTGAAAAGAGTATGCTGGAGAATAATGTGCGC
AGGAATCATCTTCAAAAATGAATGTGCTGCTTCAGATTTGGATGTAGTCAACAGTGACAGGATATCTACATCTCCTCGCGCAGACAGATAATGAAGCACC
GGACCGAACGATTCATCTACGATGGCGCAGTTGTTGATAATGTGTTCCCAGGAGGTAGAAAACTCCTCTGGTGTCATCGCTACCACCGCAGTTGTTAAAG
CGTTTGGGTCACTAAAGCGATACCACTTGCTGTTAGGCGCTCGCGCTTTCTTCTTAGGAGTAGTAGTTTTGTTAGAAACACGCTTCCCTGAAGCGAATAC
CTCACAATGAGTCTTGAGCCACATGTAGGCATCAAATTCGCATCCAGTCTCGTCAGAACTCACCGACCTCTTCCGCTTCTTTCCATTGGTATCATCACTA
GATGCTTCGTTCCTCTTCTCTTGTAGCAGGGACACATCTATGTCAACAAACGCATCGTTCTTCGCAATTAACGCGACTAATTGATGTGGATATTTGCTGG
TTGGCATCAACGCTAGCAAAATCCGCACAGCAAATACCACAACACTTGGGTCAGTCCGATATGCTGACAAATCATAAGTCCCAACTACACCATTGTGCGA
ATTGAGGAATCCCACCAATGCCACAGTAATCGGGCTCAGCGAGGATGAAGAGGATGAATCTGTCACCACGCGACTACCAACAGCAACATACATTAGAGGG
TCAGCCATCACGGCACGCGCGAGCTGTTCTGTAAACTCGGCGCAGGCTTTGTTTCCACTCTGACACAAACTCTCAAGCCAAAACGAAACTTCTTCGTTTG
CTCGTCCATCAGCACGTTGGGTCTCCTGCCCATAAATGTCCGAAGCGAGTAAGGTTCGTTGAAGGACCTTTCTTGCAAGCTTCTGTACGGCGCCACTCGG
TGTTGAAGTGTACAAAAGCAGCATTTGTTGCAACTTCGAGTGACTACCAGACCTTCCACTTGTGAAGAGGAAACGCAAGCGAGGAATATCCACAACAACC
AAAAGGCGCAGTATTTCACCAACGATCAAGCCTTGCATGGGTGCCGGCAAGGTATCTAGAGCGCCGTCTTGAGCGGGATCGTCCAAGTAACGCCAGGTAA
GAGTCTTCGTCAAATCAACCTTAACCTCCCGCATAACATGAGGGAGGCACTCCAGGTATAAGCGGAATACAGTGAGAGCACGCAAGTAGATAAGTGCAAT
ACTTCGTTCCTGTGAGACACACAATTTGAGAAGCAACGACACGAGTGCCTCGGGGCTCGGAAGCAGGAAGCGTAGTTCTGACTGCACTTCTGAAGCCAGA
CCCAATAATTCCAACGAAGACGTTAAGTGCACATATCGCTTCAGTGTTGCCTCAATCACACCCAATGAAGAGTAAATGACTAGATTGTTGCTGTGCTGAA
TACAGCGAGAGAGCTCTTTTCGGAAATTGCCTGGTGCAATAAGGCGCAACGCCAGGGACTGTGCAGAGCACCACGAAGAGAGCGCGTCTGCATTCTTGGT
CGTGGGCATTCCTGTAGCCACCGCATCCAATGAACAAGACAACAATTTCTGCACCAGTGATGCCACGCAGAACCAACGGTACACTGGCTTAGGCTCTAGC
TGAACCGACACTGCAGCAAGATACTCCGACAGGAAACCCGGGTACGTTGCGAGAAATTTCATCACGAGTGTCTGAGCTTGTGTGCTACGCAATAGTTCGT
TCACACCAATCGTACCAATAGCATTACGAAGCACCTTGAGTGCGTAGACCTGTTCCGATGTCGTCACATCTTCCTCGCCTTGTGAGTTCGCTGACTTAGC
TAGAAACAGTCTTAATGCTTGTTTCTGTGGTACAACATACAATGCACTCTCTTCAAAGAACAGTGAATTTAACACCGTAAGTGCCGTGTCCCGCACATTT
TCATCTTCCACTTGTAACAATGCCAGCAGTTGATGCACACACGTGGCATTAAACACCACAAGCTTGTTCTTGTGTTCCACCTCGTTATTATGCAGCACTA
ATTCCCCCAATTTGCTAAAAATCGTCGTCAACATCTCAACGGAATCTCCATCCATGCTCTTAAACAACGAAGCTGTGACTCCTCCTTCTTTCATCGCAAA
GCGATGGACACTTTTATCCGGACAAGCTGTAAGTGTCAGCACCAAGTCCACATACGCCGCTCTCAATTGGAATGGCTGCTTCCCTTCTTCTTCTGACTTC
CATCTCCTTGTCGCTAACTTGACAAATGCAGGACACTGGAAATTAAAAAGTCTCACCAGTTCTCTCGCTGCAACGCCACTGACTTTTGCAGTAACAGCCA
AGAGCTCAAGAGCTCGGTACTCAATAAAAGGCTTGTCACTCCAACTCAGCAGCTTTTCCAGCTGCGAACTCTTGTCTCGAATGATACGAAGCGCAAAAGC
TTCGGCTAGAGCCACATTTTGCTCTTGTTGCGTCTGCAAAAGGTGCGTCACCACGTGGAGAAATGTTGCAAAACTCTCACGTTTCTCCCAGCGACTGCCG
ACGCCGTGTTGTTCTGGCCAAATGCGAAGGAGGAGGTCGCCTTGAGGGTGGACAGAAAGGAACTGGAGACGGAGAGCTGACGCGTTCTCTGGAGACACGG
ACACTGCGTCATCTACAGACAGACGTAACGACCGAGAGAACGACAAGATAGCGTCATCTAGAGGCTGGTGGTCGCGCTCCGCCG