Description :
From Genome Similarity Track
Location :
Scaffold_750:1128- 5959
Transcript NameFunction/comments
g16999.t1hypothetical protein

Sequence
4831 bases(100 bases per row)
GTGGTCTCTTTTGTTAGTGATGAGCGGCGTCAGGAGCTGGACCAGCGCCATACCCAGGCCCTCGATGCCAACGCGTCACCACAAGGATACGAGTCTCCAG
CGTCTAAGAGGCGACGGTTGGGGCGCCGCCGCGCGGCTCAAAGGCGATTTCGGGTGGCAATGGAGCAGATGGAACAATTGAGCCTACAAGAGGCGGCCGC
AGGTGGGGGGGACGTCGTCACAGTTGCAACGGGTGAAACCGCCCCTCCTGTGCCGACGGTCGTTGGACAAGGGGCGACTAGCCAGCTCTCTGCAGGTGCT
CCAGTGCAGAGGGCGACTGACCCACAAGCAAATCCACGTCGGATGAGGGAGGCGCAGCGAGCGCGTTCCAGAAGAAGTAACATGACCGACTCTCAGCGGG
AGAGTGCGCGGCGGCGTGACGCGGAGCGAAAGCTAGCCCGGCGAGCCCAACTCCGTGCCGAGCAGCTTCGGGACGTACGAGAACGAAACCGGATCGCACA
GCAGGAACGTCGGCATAATCTGAACGAAGAGGTCCACGCCTCGGAGCGTGAACGCAATAGTGCTTCTCGCGCGCTTCACAGGAGTGTACAGGATCGCACT
GAAGAGCGCAGAACAGATCGTGAGCAACACGCGGAGCGCAGATCACAGCTTACGCAGGACGAACGCGCCGAAGAACGCATGGTAAACCAAGAGCAACATG
CGGAACGCCGCAGAGAACAGACTGAGGAAGAAGCACTTGAGCAACGCGAGAGAGAGCGATTTCGGCGTAGATCGGCTCGACGTGGAGAGGCGTTGGCAAA
CCACGACGATTTTGACGTGACCTACGTCCAGGGTCCAGACGTTGTGAATGGGCGCCATCGGCTTCCTCCCACCACTGTTTGTGAACATTGTGGCGCTTGG
AAGTGGCCTGGCGAATCCAAAATGAGCTGTTGTCTGGAAGACAAGGTTCGTCTTCCCCCTTTACGGCCTGCACCTCCAAGATTGTTGCAACTGTACCGGG
ATCCAGCGTTTCGACAACACATACGAGCGTATAACCAAGCTTTTGCGTTCACGTCCATTAGCGCTTCGTGCTCCAACCGATCCTTTCAGGACATCAACCA
GGATGCAAGCGTAGCGGGACAGAGGGGCGTGTACACGTACCGCATCCAGGGTGCAATGGGTCACTACTTGGGATCTCTACTCCCCTATATTGATCCCGCC
ACCGGAGAGCGCACGGATCCTAAGTTCGCGCAGATCTATATTGTGAGCCCGGACATGCAGCAGCGCGCCCAACGCCGCAGAGGAATCTTTGCTGACTTGG
ATCCTGTGGCGTTGATGGACATTGAGCAAATGATGGAGCAGCACAACCCATTTGCTCAGCAGTTCCTGAGTTTCGGAGAGCAAGTGCGCTCGCGAGACAC
GAGCGACGTCGTGGATATGGTGTTCCGCCTCCACGAAAATATAGCGCATCCTCGGACATACAATTTGCCAACCGTTTCTGAGGTAGGCGCGACGCTCATC
GAGGACGGCAACCTGGATAGGCCTCGCGATCTACTACTGTATACTCGGGATCACAGGCTTCTGCGACTGTTCGAGACGCGCCCGGAGTATGATCCTCTTC
AGTATCCTCTTCTGCTTCCGTATGGGGAGCTGGGTTGGACCTACACGGACACATACGCGAACGGAGTCAGACGTCGCAACAAGAACCAGATGTCCCTTCG
CGAACATGTCGCCTTCCGGTTGCACCAAAAAGTGGGAGATCAGTCTGCTCTTCATCAAGGCGGCCGTCTCTTTCAGCAGTGGTGTGTCGACCAACGCGCT
AAATGCGAGCAGGAGCAACTTCGCTGGGTGGCCTCACATCAGAAGCAAATTCGCGCCGATCAGTACAGAGGGCTTCAGGATGCACTGCTGAACGAAGGAA
CAATTCAGCTGGAAGCAGGCGAAGGGCTACTCTCCGAGTTTGACAGAGGCGATGGTACGTTGGTCCACCCTGATCGAGGCCGAGGTGGTGATACCCATTT
TCTCAACCAAGTGGGACGCCGCGTTATTCTGCCCTCATCTCATATGGGCAGTCCTCGAGCGATGTACCAGTCCTACCAAGACTCAATGGCCATTGTTAGA
GAATTCGGCAAGCCTGATGTGTTCATGACAACGACCTGCAGTCCTACATGGGAAGAGATAGTCGAGGCCCTTGGGTCCGATCAACAAAACGCTCAGGACC
GCCCCGATATTGTAGCCCGTGTCTGGCAGCAAAAACTGCAAGCTCAGCTTAAAGACCTGAGCGAAGGAGTGCTGGGCCGTATGGAAGCGCGGATTTACGT
GGTCGAGTTTCAAAAGAGAGGGCTCCCTCACGCGCACATCTTGATCATTTTGGCTGAAGAGGACAAGCCACGTACTCGCCAAATCGTAGATCGTATGGTG
TCTGCAGAGCTTCCTGACAGAGAAAAGTTCCCGCAGCTATTCGAGACAATCATGACATGCATGCTGCATGGACCCTGTGGAGCGGCAAACCCGTCATGCG
CTTGCATGAAGGACGGGAAGTGTACGAAAGGATATCCGAAACCTTTTGCAGAGGCGACAAGGACCAATGTGAACGGCTATCCGGTCTACAGACGGCGTCG
ACGAGCTGAAGGCGTCCTGGTATGGAAGGGCAGGGAGTACGACAACGCCACTATTAACCAGTGGGTTGTTCCGTACAACCCGTACTTATCCCAAAAGTAC
AATTGCCACATCAACGTCGAGGTGTGCACGGATATTTCAGCTGTGAAATATCTATACAAGTACGTCTACAAAGGGTCCGATAAAGCTGTGCTAACTGTCG
AGGCAGTTCGCGCGGGTGGAGAGCTCCCTCGGCAAGAGCCAAACGAGATTCTGCGCTTCCTCACGGCCAGGTACATATCTCCAGTTGAAGCCTGTATCCG
CTTACTCGACTTCTTGATCCAAGGAAAGACACACGCAGTCACTCAGCTTACCGTTCACGTCGAAGATGCCCAAACCGTGTTCTTCAGAGCGACGGAAGAC
CCGGAGCGTGTCCTTGGTCGTGGGAATCACACCATGTTGACCCGCTTCTTCGAATTGTGTGCGAGCGACGAACCCGAGAACCAGATCGCGAAGACAATGC
TGTACCAGGATATACCCAAGGAATTCCGCTGGATGGGAAACACGAAGTGCTGGGTTCGACGTAAAAGGTACCAGGCTGCAATTGGTCGGATGGTGCATGT
TTCACCGCGTGATATGGAGCGCTTCTATTTACGCCTGCTATTATGCCATCGCCGAGGACCGAGGTCTTTCGAAGACCTGCGGACAGTTGATGGTGTGCTG
TGTCCCACGTATCGAGACGCGGCTGAACATGCCGGCTATCTGGAGAACGACAGCGAATGGGTTTTGTGTTTGTCGGAGGCTGCCGAGTTCCAGATGCCGT
ACCAGCTGCGCCAGCTCTTTGCAACAATCTTGGTCTACTCGGCGCCTACGGATGTTCGGGGTCTTTGGGACCAATTCTTCAAAGACCTTTCGCTTGACTA
TGCGTACAGGAACCGAGAGATGTTGGACCCTTTTAAAACGTCTGTTGTGACGTTCGACACACTGAAGAGTATCCAAGACTTGCTCAGTGTCAGTGGGTAC
TCCGCCCAAGACTTTGATCTCCCTCGGCTGAGCGAGTTCCCTCGCCTGGTGCTTGAGTCTGTTCTGCAAAACAATCTCATCCGACGAGAGCTAACGGGAT
ATGACGCGTCTGTTCTTGAACAAATTGTGAGCGAGGAGGACCACCTAAACGAGGAGCAGCGCTTGACCTATGATCAGATCACCCAAGCTGTCGAGGACCC
ACAGGAAGGCAGGAAGCTATTCTTCGTTGATGGACCAGGCGGTACCGGGAAGTCGACACTGCTTCGGAACATACTGGCCAAGGTTCGTCTATCCGGGAAA
ATTGCAATCGCGGTCGCTTCCAGTGGGATTGCTTCTCTGCTGCTTATGGGAGGTCGGACAGCGCATTCTACCTTCAAAATCCCCTTGAAGATAGACGGCG
AATCTACTTGCAACATCAACAAGCGATCCCAGGTCACGGAATTGATGAGGAAAGCAAGTTTGATAGTTTGGGACGAGGCACCCATGGCGCATCGGCACGC
GTTTGAGGCAGTGGACAGAACGCTTCGTGACGTTTTGGATAACGAGGCAGAACCTTTCGGTGGGAAAGTCGTTGTGCTTTCGGGAGATTTCAGGCAAATT
CTCCCGGTGGTGAAGGGCGGCTCGGCGACAGAGACAATCGACGCATGCCTGAAGTCATCCGAACTGTGGCCACTTTTCCAGAAGGTGCGTCTGACAGAGA
ACATGCGTGTTCGCACGGCTGCCACCTCCGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGAAGGTTGGAGAGGGGAGACACGAGGTACA
CAACGATCTGGGAAATGACTACATTAAGATTCCACGTGACATGCTCATCGACAACCCCGCCGGTGATCCAGATGAGGACGAGGAGATCCGTCCGGGAGCT
ATTCCGCGAGGTATGCGGCGCATGATCGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCA
CCACCACGAACGCGATAGTCCATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGGCCAGCTCGAGAATATGTGTCCACGGACTCAGTGGAGGATGA
CGAGGACGGGAACTTATTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATC
ATGATGCGGAACTTAAATCCCGACCTGGGGT