Description :
From Genome Similarity Track
Location :
Scaffold_477:1128- 3630
Sequence
2502 bases(100 bases per row)
ACTCCTTCACCCGCCGGATTACCATCTATTTTTCACATTCATTTCCTGGTGGTTGGGGATTGGTCTCGCAATCTTGGTCCGTTGGCGGCCGGAGAATCTC
GTCATGCGAGAATGGATCAGCAATATCGACCTGTTCTTTTTTTGAAACACCTTTGTCTTCCTCGTACGATTTACCTTCAACATCCCGATGTATATTCATT
GCGACTAATGGTGGCATGTCCTTTAGTCTGGCGGTCTGTCGTCGTATGGTCTACTTTAGAAGTGACGTGTTCAAGATGGTCCACAAGTGGTCCAATCCAC
TCTTTAGGTGGGCCTTTCAGTCGATCCAACATAGTATCATATGCCAACGTGTGCTATTCTTGACATCGGCGCGATCCTACTAAAAATAGCATTTTAGTTA
GTGGTAGCATAGCGCCTTCAATCCATATGCCCAATATGACATGTGTGGGCAGAATGATATCATAACGGCTGATGTTTTTCATCTGCAAAGATGTCTTTCT
GCCGGGTCCTGCAATCATCTTTGTTGCCCAATTCGGACCTTTCGTGACCCACAACTTGTCGTTGGAATTCTTGATCCCGAATTTTACTTCTCCTGGAACT
TTGGTCGGGATTGCTTCGATTTGATCTATCGATGTTATATTCTCTTTCTCCAAGTTATATGAGGAAGTCGTCCAGAGAGATGGATGCAAAGTTCATCTGG
CAGACACAATGTACCGTCGGCCAGATCGAGACGTACCCCGGCGGGTATCATGTTGTCCATCCCCAAAATCGCTTTTTGTCCAGATTGGCCTCCCACCTAA
ATCGAAACAGTATACTAGCGATCCCGCGGGAGTAAACTTGATCTTGGTGCGTCCTGTCGTAATGTAAGAGTTCTCGCCGGTCCTCATACCTTCTTGTCTA
ACTTTTGTCGATGACACAACCAACCTTACGAGCAACGGTGGTGTAAATGAGAGGGGCTTTAGCACCAGATTCGGATAGCTCGGGTCGCTTTTACGTAATG
GATCTTTCCAACAGTTTTCGCCTGCTTGTAATATTTCATAGGCGCGTCAAAATTTCAATATCCGTGCGATTCCCCACGAGCGAGTTCGAACTCCATCGTA
GGTCCAGACCGCTGATAATCATCGATCATCCTCAAACTAGAGATGCTAGCAAAATGTTGTGATCTTAAGTAAGATGTATTCAATTCCATATCTGATTGCT
GCTTATTCTCACGACCCATCTGTACGTTTTCCACAAATGCGAAATTACAGAGCCTAGAACGCTCGGATTATAGCAAGTTCCAAACTGGCGAGCGTCCTAG
TTTAACATCTTTTAGGACTTATCTGGCAACATACTTGCATGCTTTGTAATTACGTACCACTGGCGGACCATTTTGTAGAACCCCCCACCTATTACAATTG
TGAAGGCCTCTAGACATCTTACTATACCTGATGTCGAAATGGGGTGTTCCACCTCATGCGAGTACGATCCAGATGACCTGACCTTGAAGAATTACCGGCA
AGGATGGCTAATGTCAAACTGCAACAGGCACCCAATGTGTTTCCCGGATAAACGCTTAGCGACCTCAGAGCTCAAGCCGTTGGGAGGGATCAAGATAAGG
ACTGCCCACGCAGCTGCGTGGCTACAGTAACTACGGCATTCACGAGAGATCAAGCTCCAGACGGAGAAAAGTGCCTCTTTTTCGGGGGGGGGGGGGGGCT
GTTGACCAGACCAGCGCAGATCTGGAACCTCTAACTAGGTCTTTCCGGTCAAAACCAATTGCTAGGTCTTATTGCAAGAATTAAACATGAAGTCTGCGGC
TTGGGAGTACATGTTTCTTGCCAGTACAACTATTTTAAGAATAGGTCGTACTAATCCCCTTGAACTATCTATACCGTATAAATGAGATTGGACTCAGGCT
GAATGTAAAGATTGAAGATAAATCGTTCAAGATTTAAAAAGAACATGTCGAGCACTATATTAAGACTTTGGACGATCCAGAGCTAGCGGACCAGTTGAAT
ATTCTACCTATGGCGGTCGTGTAGTAACTAGAGGACTTGCTGAGCGCGCGTCAACGGACGAATGAACGATGAGGCAAGACATTAATTTGGATCAAGAAAA
TTTCGGCAGAAGGCACCTTCACCACCTGACCGACCAACAGAGATGCACCGCCGCTCCGTGCATGCTGTTCGGACGTACCCTGATAAATCAAGCTTTGAGG
AATCCAACATGGAAATATCATACAAAAAGGAGGATTAAGGCGATTCGATCTGATGGAAGCAAATGCAGAGAAGTATCCAGGTGTGAGGACTTTGACGGAA
CTATCTGTCAAGGAGGTCAACCATCATCGCTGTCGGGTAAGGGAACCGATACCCCGTAGTTCTTCGGTCTCTCTTAACACGAGATGCGCCCACTGTGGGT
CTAGGAAGCATGCATACATGGGATTTTGGAAGCGAATGACCTGTGGTGACTGCTGTGTAAAGAAGGGCCACCCATCGGATAGCAGTTTTTTCTGTGTCGC
GG