Description :
From Genome Similarity Track
Location :
scaffold_1861:1128- 2563
Transcript NameFunction/comments
Pl_100282predicted protein
Pl_100283hypothetical protein PHYSODRAFT_311776

Sequence
1435 bases(100 bases per row)
TGGTTGTGCTGGCCGCTGTTCGGCCGTGGGGCCTGTAACCCCCGCACATGAGCGATTAGGCCTCGCTCATAGGTGTCGAACGCCTCTATGCGTTCGGCCT
GCTCGGCCGGTGTGGCGACCGCCAAGCTACGGAGGACTTCCCCTCCAAAGATGCCCGTCATCTTTCGGACCGACTCGAATTGGGAGTCAGTCAGATGAGG
GAACTCACCTCTATCCATTTTGACCACTCAGTTGCTAGTGGTCACAGAGGATTCAGGTAGTTAATCTACCCGCGTAGGCGTAGATTGACTACAAGTGCTA
CCATGCGTCCCCCTTATGTAACCCCGGTACAGACGGCCTGTCTTTATCCGTATAAATTCAAATATCCCAACTCCTCTAAACTCTATCGGCCGAAGCGACA
CGCGATCCTTCGACAAAGACGATGGTGGTGTTCCACGTGAAGCGCGGCGACCGCAGCGAGTTCCTGTTCGAGGCGTCCGTCTCCAGCAGCAACGACGCAC
TGATCCGCTCTCTGTGTCGTGTGCAGAATTTGCGTCTCCGACTGGCGGCGCTGGCCGACGCTTTGGAAGGTTTGGGACGCTATGGGGTGGCCAAACCTCC
ACAGGACCAGGGATTGGACGCGTACCAGGAAGGAGCAGCCGACAAACAACGAGGCGAGTTCTACGAAGCTGATCCATTGGGTCATCGCACGGGAGAAGGC
GTGAGTCCGCAGCTCAAGGACGTCCTGGCACGAGTGGCAGCCGACGCCAAGAAGATGCTGGACAGCAAGACACAAGTGGCTCGACGCGTCTGCATTGAGG
AGAGTGAGCTGCTCGAGAAGCTGCAGAACATCCGTGGAGCTGTGGCCATGGCCTTCCCCATGGGGCTGCCGGTGCACGATCCAGTGAAGCTCATGCTGGA
CGCCGAGGGGGTGGAAGACGCGCTGGCCGATTCGTCGGCTGTGCTGGAAGTCATGCCGGAAGACACGACGGAGCTCTGGTGGGCTGGCAAACAGTTCTTT
CGTGACCAAGATGTGCGCGACCTAGTAGGAAAGAACGAAAAGACGACGATCATCGTAAAGCTGCAGAAGAGAGGAGGTGGGGCACCGAGTCGAGAGCCTG
GGGTGAGTGAGGACGAACGCAAAGCGATGATGGCGTTTTACTTCAAGAAACAGCAAGAGTTACAGCACGCGGCGGAAGATGATGCTGAAGATTACATGAT
GTCGTCTTGGGCTGATCCCAAGGCGCTCAAGAACTCGCTACGTGGTACTAGTAACATTAGGCCCTTTTGATCAGACAACAGAGCACTGAAAACAAACTGC
ATTCCCAAACTTTCTTCTCGACACGTGTCATACTTGAGTACATGCTAACTGCATCAAAGTGATGACCCCAGTTACATCGTTTATGCTTCACGTAAGAAGA
CCTGGTTCACTGCGAGGACTCCACTCCCAGGCTAC