Description :
From Genome Similarity Track
Location :
contig_27:112755- 114500
Transcript NameFunction/comments
g7288.t1hypothetical protein

Sequence
1745 bases(100 bases per row)
CTGTCGTCGCCTCCAAGGCGACGACGGCCGCTGCCTCAGCCACGACCGCTACTGGCATCGCCTCGACGGCGATGCCGACAAGCGCGGCAACAGAGAGTCG
CCTCTCTGTTGCTGGATACCACTCGAGATGGCATGAGAAACATGCCATCCGAAACAAGACAGGCAAGATCATTGCTGTCGAAACCGGAGTGGGCATCTAC
TCTCCGGGTGGAGAGGGAGTTCCCCTCGACTACGGAAGTGAAGTCGAGGAGGGGGAACTCGAAGGAGACAAGGACATGTCTCCGGGCCACACTGACCCAA
TGTGGGTCTGCGTCGTCCACGCGAGGACGACCCGAACGCTTCGAGCTCGAAGCGTTCGCGCAGCGGCAGTGGAACACCGCTCGCTGCCGCTGGAGCCTTG
ACGACTCCGCGGGATGGAGATGACTCCACTCCATCCGCTGTTGCGGCCTCGCGCACTGAACCAGTGCGCGAGCCGTGGATGCCGTCTCAGTCTGAGATCG
GCAGCCGATTCGGTGCGACCGCGCCACCGAATCTGTACGCGCTGTATCGTGCAACGCCATCGTTGACGATGACGTCGCGAAGCGAGTACACTTTGATCCG
TTAACGAATCAAAGGCGCGACTACTACATCGGGCTCTTCCATGAGCTCCGATGGTTTGCGAGCAAGAAGACTTCTCGCAGAAGCAAAGTGCCCGAGTGGC
AGGCACTTTGTCAAAGTTGGAGTGCCTTTGTTGAAAACTTCAACAAGAACCCCGCTGGCTATCGCGACCGGATTAGCCAGGCGCGGGAGCGCTACGAGAA
ATTCTCGAAGCGTGGTAAACTTGAACGACTGCACCATGGTGCAGTCGGTATTGGACTTCCTTGCGCAGTGCCTTATGACACTGCTTGTGAGTACTGCTAC
CCCGGAGCAGTACGCATCACCGAGCGGGACGTCAACGGGTACACGTCCATGTGTGTACCTGACGACCTCAAGACCCTGCGCGCCAGTTTTCAGGCGCAGG
CGTCTTCTAGTGCTGCGGATAATCGCAGCACTTATCCGAGTGCTGTAGGCGACTACAGCGCTCGCCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTGG
CGGCCTTCGTACGCCGTCACCATTTCCGGAATGTCCTCCATCAGGACATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATAC
GAAAATGAACCCGGACCTCGGGTCTGGTTCCGATGACCAACAATTCGCTGGACGATCCAGCGAGTTGCCCCGCGTGCGTCTCGCAACGGGGGTGGGGGGG
CGGGAAGACGCCCCGGGTTTGGTCAACCAAACCTTGAGTCTCGCTTGGAGGCTGTTGAGCGTCTCCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCT
GAGCTTGTTAAAGGCTCAGCTCGCGGAGGTTGCGCAGACGACCTCGAACGTAAAGGTCGAGGTCGGGACGAGACTCTCTGGCGTCTCGAAGCGCGTCGCC
GCGCTCGAGAGCGCTTTGGCGAGTCACCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCT
GGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACT
GCATGTTTAGCTAGGTTCTGAGTAGCTAACAGAACTAATGAACCA