Description :
From Genome Similarity Track
Location :
Scaffold_592:11274- 12959
Transcript NameFunction/comments
Phyci_22059Hypothetical protein

Sequence
1685 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACACAATCGCGTAGTATAGTTTTT
CCAAGTCAAAATCatgcggaggttcacggaggttcacggtgcgtttaaaacgactttactgcccgtgaacgttcagatcgtaaaccgattgtgaagctga
acgttcacagcCCTAgttcgtggcagggtgagaacaatttgtccatcgcgcagtaccactatcaaatgtctcatacctccaaatccctacaaatgcttca
aacagcgctagtatcggcatgctgtttgcatgccttgccatggcacaagcagctacgaaagccgggcttgattcattcgtcattagaaactctagttatg
ttccgactaaaatttcattgaaataggacaatttccgcatttaatgttttgtttagtttcccccaataaagtccccctcttaactggatcgcctgttaAT
AATACTCTACAGTAGCTGAACCTCGGAGTGAAGTGCAATGGCAGAGCCAGAGCAGCGCGAGTGAACCGTGCACGAGAAAATATCGTAAACACCATATGAT
CTCTAATAAACACAATAtgtatcagatatggctactgtaccagtttagtggtacaactacttagcaagggtattgataaataaaggggctccctcagcca
cttgttggggtgcaggacagttggtcggggaatgaccagcacttcgtgatttccccgccagccccaagcatctcctcctctccctccgcccacCGCAGGG
TCAGTTTTGTAACACTGGTAGCACTTGTTGGTCAAGAACCGACGACCATGGCCCCTGCGACGCGCAAGAACGACCACGACGCACCAGCCGTGGAAGGGGA
AAGACAAGCGGAACTAGAGGCACAGCTCGCACTGCTGCGAGCCGAAATTGTGACCCTACAGGCCAAGAAGCACGGGCCGCGCCCGCcgatgaccgagtcg
aagcctcgagtcccaagcggtctgcccaagttcaaggggaagcgcgacgaggacgtacgccagtggctcttccaagtggagacgctgtaccgcatcacgg
ccacgacccgacggacagcaacgacacgctgcgggcaatcgctggtaccgcgatggaagaacctgcattgggatggttcctgttctgggcctctcgaacg
ccagcggaggagcagacatggggacggtttacccacgatgccctcgcgcactttgaagtgtcaacctaccaagcagtgctccggcagaagcttcgtcaac
tccgttagaccggcgacattgaagagtacaacaggaagtactcggcgctgatcttcagcgttgagaatatgagcgAAGTGtgtggcgaagcgggtgagcg
ccttttgccgcccaggtgtatagcacgatgccacggggccgcccgtccggagaattactcctccttccggatttcccaatggggtcagactccgaaagca
gcactaggtgctccaaacggaggtggcgtgtgaccttgtgaatccctgtaggtgtcgtttatcttcgatagaacgaacttcacct