Description :
From Genome Similarity Track
Location :
Scaffold_137:112739- 114619
Sequence
1880 bases(100 bases per row)
TGGCTCTCTATTCGTGGAGTATAGTTTCTCCGTCGATTAAAACCCAGGACGACTTAAAGTCGTCGCTGAAGAGCTTTCGCGCCGGCCCGATTTCGAGCCG
GCCACGCGATTCAACAGTGAGGATGAGCCCACTGTTGCAACACTAGTTGCAATTGTTTTGTCGTCAACACTGCTTGATGACGTGAAGAAAGCATACACGG
AAGGTAAGGATCTTCTGCGATTAATGGATCGTATGGTAAATCCATCCCGGCAATTATTAAAGGGATAAGCGGCTTTGTACCGATCCTCGTCGGATCGGCA
CACAACACGCAATGGGTTGCTGTACTATACAGCCGTTGCCGGCGACACTCTTCGTGTCGTCGTTCTCACTCATAATGATTTTCGTTTGCACATCATGTAT
GAGTGTCACGATGCACCAACAGGTGGGCATCGTGGTAGAGAAAAAACTTACCTTACGGTAAGTCGCGACTGTAACTGGCCCCGCCAGTATCAGCTCGTGC
GCAAGTAAGTTCGTGCTTGCGAGGTCTGTCAACGGGTGAACCCTAGTCCTTCATCTCGTGCACCGTTCCAGCCTCTGCCTGTTTCGGCAGAGTGCTGGCA
GTCCGTGTCAATGGACTTCGTCTTCGTAATCTTCGAAGACGACCACAAGAATAATCGTATTCTTGTGTTTGTTGACCGATTCAGCAAGATGGTACATCTT
GTTGCTGTACCGGAGTCAATAAAAGCCGAGGGCTGTGCTCGTGTCTTTACTGACACGTCCTTTTGACTCCACGGTTCATCCCGTGGACTGATCTTTGATA
GAGATCCGCGGTTCACGGCGGAGTTTGGCAATCCGTGTTCCATACTCTTGGAACACTGTCGAAGATGCCATCTTCTGACCATCTTGAAGTAGATGGTCAG
ACGGAACGGTATTCGTGTCCCACAAAAGTGGGGGACGTCACTGTCTGGAAGGACAGTGCTGCTGAACCCCATCACACCAGATCCCGAAGGCTTAACACCA
GAATCCCTAAGGCTTAACTTCTTCCCCCGCCGGGGACCGAACCAGTGCCCTATGGGATGACGCTGCCACGCCTTCCCAGTTGAGCTACTGTGCGTATGTA
CAGTCGATGGGTTTCTTCGATAATAACCCACTTGTTAACAATTTGGAGTGGGTCCTTGCTGATGGCAGACAGTTGCCATCAACAACTCGGTGCATGCGTC
GCGACGCGTACACCGTTCTTCGAGATGTCTTGCGCCATCCACGTATCCTGGCCTTATTAGAGTGTGACTCTGGTTCAAGGGGGGAGGGACTCGCTCGAGC
AAAAACCGTTCTGGCTTTTGCTCATCATGTGGTGAATTGAACGTCACCGCAAGGGACACCGACGTCGACTAATCGACATCGAAGAAGAGAACCACAGCGA
TATCAAGGAAGATACACTGACTCTGATGCTAATGACGATGCTAGTATATTCAGCATCGCCAAAGGCTATTCTAGCGAGGACGATGACGCCCTCGCTGACG
AAAACACCGTTAAATACACAGTGCCCACTAAGCGCACTGGATCAAACAAAGCCGAGTGAACAGATGATTTTCTGCTGACTTGAGAAGCAGGTATCCGTTT
CGTACAGGTCTCCATCGCTAACGCGGTGGACTGACAGAAACGGAAGGCTGACAAGAATGGAAGATCAAATGTGCTTCTATTAATTGTTAGTCACCTAGTC
CTACTGTCTACGGTTAACCTACCCAGACATGTAGTGACTAACGTGGGTAGTAGTTTACTACTACCCGAGTACACTGGGCCCTGTCGTGTAGTGCACCGCC
AAGGCAACGCATACACGATCAAGCAGCCCCGTAGGATGCGTACGCCTCCTACGTTTTAGGTGGGGCATCTTTGCCCGTAC