Description :
From Genome Similarity Track
Location :
Scaffold_3:1127044- 1128548
Transcript NameFunction/comments
Physo_329413predicted protein

Sequence
1504 bases(100 bases per row)
TTCAGCATGAACTGCGCCGAGGATTTCCCCGGCATACTGAGCCGAACTTCTCGTCCCTTTTCAAGAGGTGACGACGCATGCACGACCAAGCGCTGCGAGC
TCTGGTCCACCTCGATTTGATTGGGAGGACACGCCTCGTCGCCTTCGTCGGCGACGTCCGTGCAGATCCCGATCGTGTCCAGCACAGGCGCCAGCACCAC
GTCCGCCTCGTCTTCTCCCACTGGGAACGCGCTCGCCCAGACGACGCCCATCGCCCAGCGGAATTTATCGAGAGTGAAGTCTTGCTCCTTGAAGATCGGC
GGGTCGACAGCCTCCGGCGACGTGACGGGCTGCAGTAGAGCGTCGTAGAACGCTTCGACCGCTTGAGCCCTCCCCAAAGTGTAGCGCAGCAGCTGAGACC
CCTCCATCTCCTTGAGCTGGTTTTCGGAGTAGAACAGCGTGCTGTTGATGGCTTCAACGCCAGGCAACGACGATACGAACTCGGAGAAGTTGGACTTCGC
TCCAAGCGCCTGTTCTTCCAGTAGGTGCAGCCCCAACGCGATGGCCGGCGGTAGATCCGGGTTCACCTCCAGCAGTAGCCCCACTCTACCTCTAGCCGCC
GACGCCACACTCATCACCTTGCTCATTGGCAGTGACAACAGCTCGGCGCCTTGCTCCACGTCCTCCGTCACAGTGTAGGCCATGCCACGTCCGAAGTTGA
ATCCTTCGGCTTTCAACACGGATGAAGTAGGGGATTCTACCTTGGCTGCACCCCCGATCGGTCGAATGTTGATCCCCACTGGGCTCCCATCAGGGAACGC
TGTGCGACCTTCGAGCACCGGCCGATCCGAGCGAGAGGCGGCGTAGCCTCCCCATTCCGCTTTGGAGTCGGGGTCTAGGTCGAATTCCACTTCAACGTCG
GGTCTCGCAGCAGCGACGACGTCCGGACTGGCGTCGATCGATAAGGGCGAGGCCGACCGACCTCCGTACAGCAGCAACAGCGAGAAAACACTCAGGAGCG
ACACCATTCTTGAGCAACTTGGCTTGATGAGGGGCTTTTCCGGAATGACTGCCACGAATGACACGCATGGTATCTTTCTAGCGATCTTTGCTCACGAAAG
GACGCAGTGTGGTGCACACCAAATATCCTTACGAAAGGAACATAGTGTTGTGCACACAATATTCGTAGATTTGTTTTTAGGTCATCCATTTGAAGTGGAG
GGTGAAATCAACGCCTAATTACCAGACAAAAAAGGTCAGTACATTCATCATAGGTAGTGCTTCGGACTTACCGAAATGGTCGATGCGATACGTGAGCGTA
ACGAGCATCCAGAGCACGAGTTTGGTCAGAATGGGGGCCATCTGCGTTTCCAATACGAACGCTAGCTGGTACACGACTTGAATCCCGCAGTTCCTCTTCG
TGATCATCACGAGGATCACGAACGATATAAACTCCAGCAGGGCGTAGACGAACATGGGAGACACCATCTCGCGGACGTTTTCGTCCGTGACGCCGATCAT
CTCT