Description :
From Genome Similarity Track
Location :
Scaffold_1008:1127- 3197
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1008-fgenesh-gene-0.0ATP-binding cassette sub-family F member 2

Sequence
2070 bases(100 bases per row)
CTCGCGCCAAGAAGGAGCCCAAGGAGAAGAAGGACCGCAAGGAGAAGAAGGTGACCAAGAAGGCGCTCGCCGATGAGAAGAAGAAGGCCGACAACGATGC
CGCGCTCTCGAGCATGTCGCTCGCGGACCGCCTCGCCGAGGACGGCATCATCGCCACGTGCTCGCACAACGCGCGCTCGCTGCACAAGAACTTCAAGGAC
ATCAACGTGCTCAACTTCTCGATCACGTACTTTGGCAAGGTGCTCATGGAGGACTGCGACATCTCGCTCAACTTTGGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCAAGTCCACGTT
CATGAACGTGCTCGGCGCGCGCGGTATCCCGATCCCAGACAGCATCGACATCTACCACTTGAAGCACGAGATTGAGGCCAGCGAGATGACTGCGCTCGAG
GCCGTGCTCTCCGTCGACGAGGAGCGCGGCAAGCTGCAGTCCGAGGCCGACGAGCTGTCGGAGCGCATGACCGACGAGGGGCTGCCGGAGGAGGAGAGCG
AGGCCATCTCGGAGCGCCTCACCGACCTCTACGAGCGCCTCGATGAGCTCGACGCCGACACGGCCGAGCTCCGTGCGCGCAGCATCCTCAAGGGTCTGAC
GTTCAGCGACGAGATGATGGCCAAGAAGACGCGCGAGTTCTCCGGTGGCTGGCGGATGCGTATCGCGCTCGCGCGTGCGCTGTTCATCCAGCCGACGCTG
CTTCTGCTCGATGAGCCGACGAACCACTTGGACATGGAGGCCGTGGTCTGGCTCGAGGACTACCTCTCCAAGTGGAACAAGATCCTGCTCATGATCTCGC
ACTCGCAGGAGTTCATGAACGAGGTGTGCACGAACATCATCGACCTCACGGCCAAGAAGCTCGTGTACTACGCCGGTAACTACGACTCGTACGTCAAGAT
TAAGGCCGAGAAGGAGGAGAACCAGATGAAGAAGTACAACTGGGAGCAGGACCAGATCAAGCACATGAAGGACTACATCGCGCGCTTCGGCCACGGTTCC
GCCAAGCTCGCGCGCCAGGCGCAGAGTAAGGAGAAGACGCTCGAGAAGATGGTGCGCGAAGGGCTCACGGAGCGCGTGCAGGCCGAGGTCATCGGCGACT
TCAAGTTCCCGAACCCGGAGGCGATCCCGCCGCCAGTGCTCATGTTCCAGAATGTCGCGTTCGGGTACCCGAACCAGCCGCTGCTGTACAGCGACGTGGA
GATGGGCCTCGACTTGGACTCGCGTGTGGCGCTTGTGGGCGCGAACGGTACGGGCAAGACGACGCTGCTCAAGCTCATCACGGGCGATCTCGTGGCCGTC
TCCGGCAACGTGCGCCCGCACAGCAAGCTGCGTATCGCGCGCTTCTCGCAGCACTTCGTGGACGTGCTGGACCTCGAGCAGGCGCCGCTTGAGTACTTCC
GCTCGCTCTTCCCGGGCAAGTCGGTCGAGGACGTGCGCAGCTACCTCGGACGCTACGGCATCTCGGGTGAGGTGCAGACGCAGATCATGGGCCAGCTCTC
CGACGGCCAGAAGTCGCGCGTCGTGTTTGCGTACATGGCGCAGCAGAACGCGCACATGCTGCTGCTCGATGAGCCGACGAACCACTTGGACATGGAGTCC
ATCGACGCGCTCGCGCGCGCGATCAACGAGTTCCAGGGCGGCATGCTGCTCGTGAGCCACGACATGCGCCTCATCTCGCAGGTCGCCAAGGAGATCTGGA
TCGTCGAGAACCAGCGGATCCGCGTGTACGAGGGCGAGATCGGCGACTTCAAGATGCAGGTGCGGAAGCAGCTCAAGCTCGGCGACAAGTAAGCAAACAA
GCGAGTGGTGACCTGGGCGGCGCTATCAGTTGTCCGTCATTATTCCGCTTTCAAGCACGAGCTTCTTTAG