Description :
From Genome Similarity Track
Location :
Scaffold_978:1127- 2443
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_978-fgenesh-gene-0.1Calcineurin-like phosphoesterase

Sequence
1316 bases(100 bases per row)
GTCGCGACGAGCACCCAGGCCTCCAGGTCGATGTCCTGGCCCTGCTCGTCCTTAAACTCGGTGATCGTAGGCTGCGACGGGTCGGTTTTCCGGTCCATCG
TCACGCGCAGACCCGAAATGTGCGGGTGGGAACCCGAGAGCTGCGGGTACTTGGAGAAGTGCTCCAAGATCGCATCCCGGAAGTCGCGCGCCTGGATGCG
TACGACCACAGCTGGTCGCGGAAACGGCATCTCGTGGTTGAGGATGCCCACGGTGACGTTTGTCTTGGCCTCGTAGCTCTTGTCACCGCGGATAAAGCCG
CCGTTGATGAGTCCAAAGTTGGTAGCCAGCTCGCTGCGCAGCGCGTCGGCCACGAGGTTACCCATGTTGCACTCGCCCGAGCGCAACAATGACGTCTTGG
TATTCAGCGGCAGCGCCAGCGTCGCCAGCACGCGAGCGTTCTCTCGTGCACTTTCCTCGGTTTCCATGGACGCCATGTACTTGTGCACGATCTTCTGGCA
CTCGGGCTGCGGCGGTGTGTGCTGGTTCGCGAGCATGGTCCACTGCGGACAGATCGCTAGCGGCCGCTCCGGGTGCTTAAGCGACTTGGAGATGTGGAAC
TCGAGCTTTGCGAGCCAGAAGGCGTTCTGACCCGATTTGTGGATGAACGTCTTGCCTTCGTACAGCGTGAAGGGCTCGTGGTCGTGGCCGCCGATCATGA
CGTCGATGCCCGGGACCTTGCGAGCCAGCAGCTTGTCCTGCGCGATGCTCAGGTGCGTGAGCGCGATGATGAAGTCCGCTCCCTGAGCCTGGAGTTCGTC
CACGCAGCGCTTTGAAGTGCTGAAGACGTCCTGGAACATCACGTCGGGCCCCGGGAACGACAGACTCGGCGTCTCCTGCGTGCAGACGCCAAAGATGCCG
AGCTTGAGGCCGTCGCTCAGCTCAATGATCTCCGTGTCGATGACGCGATCAAAGAGCTTCTCCGAGCCGGCGTCGCGCACGTTCGATCCAAACCACTTGA
ACTTGGACGCAGCCATGCGCTGCTTGAGGACCTGCGCGCCGAAGTCGAACTCGTGGTTGCCCAGCACGACGTACTCGATGCCCAGGTGGTTCATCAGCTC
AATCATGTGCGCTCTGCAGGTTATACACATATCAAACACATGTTAGAATACACAGAGCCACCTACCATGGGCGTTATGTATGGGACGCACCCTTGGTGTC
GCTCGCCGACCTCCGAGCCGGAGAGAAAGTCGCCGTTGAGCGTCACGAGCAGCGTCACGTCCTGCGGCAGCGCCGCCTTCTCGCGCTCCAGCAGCGTCGC
GAGCTCCGCGATGCCT